Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vector and preparation for knocking down human CBS gene as well as preparation method and application thereof

A carrier and gene technology used in the field of biopharmaceuticals to inhibit cell growth and reduce the migration rate of cancer cells

Pending Publication Date: 2021-06-18
HENAN UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the treatment of thyroid cancer by preparing related drugs that knock down the cystathionine β synthase (CBS) gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector and preparation for knocking down human CBS gene as well as preparation method and application thereof
  • Vector and preparation for knocking down human CBS gene as well as preparation method and application thereof
  • Vector and preparation for knocking down human CBS gene as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Preparation of the carrier for knocking down human CBS gene

[0042] A carrier for knocking down human CBS gene, the preparation method of which comprises:

[0043] S1: According to the human CBS gene sequence, design primers for PCR amplification of the target gene, see SEQ ID NO.1 for the specific sequence;

[0044] S2: Digesting the restriction enzyme sites BamH I and Hind III in the GV102 vector to form a linearized GV102 vector, the sequence of the GV102 vector is: hU6-MCS-CMV-GFP-SV40-Neomycin;

[0045] S3: Ligate the products of step S1 and step S2 to construct a GV102-CBS vector.

[0046] S4: PCR identification, amplification of human CBS gene, and agarose gel electrophoresis.

[0047] S5: Positive clone sequencing to identify the correctness of the human CBS gene in the GV102-CBS vector;

Embodiment 2

[0048] Example 2 Preparation of a vector for overexpressing the CBS gene

[0049] A carrier for overexpressing human CBS gene, the preparation method of which comprises:

[0050] S6: According to the human CBS gene sequence, design primers for PCR amplification of the target gene, see SEQ ID NO.2 for the specific sequence;

[0051] The specific sequence is as follows: CGAGCTCAAGCTTCGAATTCCGCCACCATGCCTTCTGAGACCCCCCAGG

[0052] S7: Digest the restriction enzyme sites EcoRI and BamHI in the GV230 vector (vector sequence: CMV-MCS-EGFP-SV40-Neomycin) to form a linearized GV230 vector;

[0053] S8: Ligate the products in step S6 and step S7 to construct the GV230-CBS vector;

[0054] S9: PCR identification, amplification of human CBS gene, and agarose gel electrophoresis;

[0055] S10: Positive clones were sequenced to identify the correctness of the human CBS gene in the GV230-CBS vector.

Embodiment 3

[0057] Determine the optimal concentration of geneticin G418 and puromycin through drug susceptibility tests, that is, the lowest concentration of G418 and puromycin that can completely kill cells;

[0058] Specifically:

[0059] Human thyroid cancer cells TPC-1 and ARO were digested and inoculated in 96-well culture plates with an inoculation amount of 1×104 cells / well; after tumor cells were inoculated in 96-well culture plates, 100 μL of G418 or Puromycin medium, G418 gradient settings are: 100µg / mL, 200µg / mL, 300µg / mL, 400µg / mL, 500µg / mL, 600µg / mL, 700µg / mL, 800µg / mL, 900µg / mL, 1mg / mL; Puromycin gradient settings are: 1µg / mL, 2µg / mL, 3µg / mL, 4µg / mL, 5µg / mL, 6µg / mL, 7µg / mL, 8µg / mL, 9µg / mL, 10µg / mL ; After adding the medium containing G418 or puromycin, observe the cell culture situation regularly to obtain the lowest concentration of G418 and puromycin that can completely kill the cells;

[0060] The results showed that for the above two human thyroid cancer cell lines, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vector and a preparation for knocking down a human CBS gene as well as a preparation method and application thereof, and relates to the technical field of biological pharmacy. The preparation method of the vector comprises the following steps: designing a primer for PCR amplification of a target gene according to a human CBS gene sequence, and the specific sequence is as shown in SEQ ID NO.1; restriction sites BamH I and Hind III in the GV102 vector are digested to form a linearized GV102 vector, and the sequence of the GV102 vector is hU6-MCS-CMV-GFP-SV40-Neomycin; and connecting the products obtained in the previous two steps to construct a GV102-CBS vector. The vector prepared by the invention can obviously inhibit the expression of human CBS genes, achieve the purposes of inhibiting the growth of human thyroid cancer cells and reducing the migration rate of the cancer cells, and can be used for preparing a preparation for treating the human thyroid cancer.

Description

technical field [0001] The invention relates to the technical field of biopharmaceuticals, in particular to a carrier for knocking down human CBS gene, a preparation, a preparation method and application thereof. Background technique [0002] Thyroid carcinoma (thyroid carcinoma) is the most common malignant tumor of the endocrine system and belongs to the tumor of the thyroid epithelium. It includes four pathological types, namely papillary carcinoma, follicular carcinoma, undifferentiated carcinoma and medullary carcinoma. With the exception of medullary carcinoma, approximately 90% of thyroid cancers arise from follicular epithelial cells. Papillary carcinoma is the most common type of thyroid cancer with low malignancy and good prognosis. At present, the treatment methods for thyroid cancer at home and abroad mainly include surgery, thyrotropin suppression therapy, biological therapy and traditional Chinese medicine therapy. However, there is no report on the treatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/66C12N15/60A61K48/00A61K31/713A61P35/00
CPCC12N15/1137C12N15/85C12N15/66C12N9/88C12Y402/01022A61K31/713A61P35/00C12N2800/107
Inventor 吴东栋李见梅王迪祁慧雯王怡禛敬米蓉张艳霞蔡春波李彦章姬新颖
Owner HENAN UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More