Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Single domain antibody, recombinant antibody, encoding gene and preparation method and application

A technology of recombinant antibody and single domain antibody, which is applied in the fields of genetic engineering and pest control, to achieve the effect of delayed evolution, small molecular weight and short production cycle

Active Publication Date: 2022-07-12
JIANGSU ACAD OF AGRI SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at problems such as the widespread resistance of Bt crops and Bt preparations and the limitations of existing Bt synergists, the present invention provides a recombinant antibody that has a synergistic effect on Bt toxin, a gene encoding the recombinant antibody, and Its preparation method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single domain antibody, recombinant antibody, encoding gene and preparation method and application
  • Single domain antibody, recombinant antibody, encoding gene and preparation method and application
  • Single domain antibody, recombinant antibody, encoding gene and preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0036] In the present invention, the recombinant antibody is preferably prepared by prokaryotic expression. In the present invention, the specific preparation method preferably includes the following steps: cloning the gene encoding the recombinant antibody into an expression vector to obtain a recombinant vector, then transferring the recombinant vector into a host bacteria to obtain a recombinant strain, inducing the recombinant antibody The recombinant antibody is obtained by expressing the recombinant strain.

[0037] In the present invention, the expression vector is preferably pET-26b(+) vector; the host strain is preferably E.coliBL21(DE3). In the present invention, the steps of the synthesis of the gene encoding the recombinant antibody, the preparation of the recombinant vector, and the transformation of the recombinant vector into the host cell are preferably performed by a biological company. In the present invention, after the recombinant strain is obtained, seque...

Embodiment 1

[0043] The human single-domain antibody library in the form of TG1 host bacteria purchased from Source BioScience in the United Kingdom was rescued as a phage-displayed antibody library using the KM13 helper phage (for details, please refer to the literature (Selection of humanantibody fragments by phage display, NATURE PROTOCOLS|VOL.2NO. 11|200, doi: 10.1038 / nprot.2007.448); take the phage display library for targeted screening of the diamondback moth BBMV.

[0044] The preparation process of the diamondback moth BBMV is as follows: select the 4th instar larvae of the second day of the diamondback moth for dissection, wash the dissected midgut tissue with 0.15M sodium chloride and put it in an ep tube on ice. Good samples were placed in a -80°C refrigerator for later use. BBMV is obtained by the Mg-EGTA sedimentation method, and the specific operation steps are shown in the references: Wolfersberger M, Luethy P, Maurer A, et al. Preparation and partial characterization of ami...

Embodiment 2

[0050] Bispecific single chain antibody 4C1V H -2D3V L Prokaryotic expression of (recombinant antibody)

[0051] 2D3 is a monoclonal antibody that can broadly recognize Cry1A toxoid (see references: Construction, Expression, and Identification of Double Light Chain (V L -V L ) Antibody from a Unique Bt Cry1-Specific Monoclonal Antibody, Food Anal. Methods (2020) 13:1570–1582, https: / / doi.org / 10.1007 / s12161-020-01754-y), the light chain of 2D3 can be variable region V L The sequence and the sequence of 4C1 are connected by a 45bp linker, and a single-chain antibody 4C1V with a size of 786bp is obtained by splicing H -2D3V L . The nucleotide sequence of the linker is as follows: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG (SEQ ID No. 7).

[0052] The corresponding amino acid sequence is as follows: GGGGSGGGGSGGGGS (SEQ ID No. 4).

[0053] single chain antibody 4C1V H -2D3V L的核苷酸测序结果如下:CAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCTCCTGTGCAGCCTCCGGATATAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single-domain antibody, a recombinant antibody, a coding gene, a preparation method and an application that specifically bind to insect BBMV, belonging to the fields of genetic engineering and pest control. The amino acid sequence of the single-domain antibody is as shown in SEQ ID No.1 As shown in the figure, the recombinant antibody with synergistic effect on Bt toxin includes the single domain antibody, the connecting peptide and the variable region of the antibody light chain that recognize the Bt toxin connected in sequence; Both BBMV and the four Bt toxins have high specific binding activity, and the recombinant antibody can increase the lethality of the above four toxins to the diamondback moth larvae from 23.3 to 38.3% to 63.3 to 88.3%, and has a synergistic effect on the above Bt toxins. The effect is significant; the application of the recombinant antibody can effectively improve the control effect of Bt preparations or Bt crops on pests, and effectively delay the evolution of Bt resistance of target pests.

Description

technical field [0001] The invention belongs to the field of genetic engineering and pest control, and in particular relates to a single-domain antibody, a recombinant antibody, an encoded gene that specifically binds to insect BBMV, and a preparation method and application. Background technique [0002] Bacillus thuringiensis (Bt) is one of the most successfully applied bioinsecticides. The insect-resistant crops produced by transgenic Bt insecticidal genes into plants for stable expression have opened up a new field of Bt applications. chapter. Since its introduction in 1996, farmers have cultivated more than 930 million hectares of this genetically modified crop, effectively suppressing the population of target pests, reducing dependence on conventional pesticides, and increasing farmers' income. However, prolonged intensive planting of transgenic Bt crops has placed enormous selection pressure on target pests and led to the evolution of their resistance. Given that the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/18C12N15/13C07K16/46A01N37/46A01P7/04
CPCC07K16/18C07K16/1278A01N37/46C07K2317/569C07K2317/31C07K2317/56Y02A50/30
Inventor 高美静刘贤金卢莉娜胡晓丹仲建锋张霄徐重新谢雅晶朱庆林曼曼陈蔚
Owner JIANGSU ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com