Supercharge Your Innovation With Domain-Expert AI Agents!

Detection and application of methylation sites of human FITM1 and HIST1H2BJ genes

A methylation and site technology, applied in the field of biomedicine, can solve problems such as unreported relationship with liver cancer

Active Publication Date: 2021-05-07
杨小丽
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the relationship between the abnormality of the gene and the abnormal methylation of the gene promoter region and liver cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection and application of methylation sites of human FITM1 and HIST1H2BJ genes
  • Detection and application of methylation sites of human FITM1 and HIST1H2BJ genes
  • Detection and application of methylation sites of human FITM1 and HIST1H2BJ genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] 1. Specific site analysis

[0041] use Infinium HumanMethylation27 BeadChip Methylation microarray screened the difference between the methylation profiles of primary hepatocellular carcinoma and corresponding paracancerous tissues, and found that in the genomic DNA of primary hepatocellular carcinoma, a site in the promoter region of the FITM1 gene ( The methylation level of this site numbered (cg06186808) in the above methylation chip was significantly higher than that of the para-cancer group, and the methylation level of a site (cg04424621) in the promoter region of the HIST1H2BJ gene was significantly lower than that of the para-cancer group .

[0042] The sequence of the FITM1 gene-specific site is (SEQ ID No.1):

[0043] CCTGCTCAAGGTGCTGCTCTGGGTGGCCTCTGCCTTGCTGTACTTTGGAAGCGAACAGGC[CG]CCCGCCTTCTGGGCAGCCCCTGCTTACGGCGCCTCTACCATGCCTGGCTGGCAGCAGTGG

[0044] The sequence of the HIST1H2BJ gene-specific site is (SEQ ID No.2):

[0045] GTAAGCAACTTGGGATATTAGGCCTTTCCAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides detection and application of methylation sites of human FITM1 and HIST1H2BJ genes. The invention discovers specific DNA methylation sites of genes related to primary hepatocellular carcinoma population, including the methylation site cg06186808 of the FITM1 gene and the methylation site cg04424621 of the HIST1H2BJ gene, and designs a pyrosequencing PCR primer and a pyrosequencing primer for the specific sites, and methylation of the specific sites can be quickly and accurately quantitatively detected through pyrosequencing.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the detection and application of human FITM1 and HIST1H2BJ gene methylation sites. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Liver cancer is the third most lethal malignant tumor in the world, and it is also the second cancer "killer" in my country. At present, the treatment of liver cancer is mainly based on surgery, radiotherapy and chemotherapy, combined with immunotherapy, traditional Chinese medicine and other treatment methods; however, due to the unclear pathogenesis of liver cancer and the lack of effective therapeutic targets, the treatment effect of patient...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6858C12N15/11
CPCC12Q1/6886C12Q1/6858C12Q2600/154C12Q2531/113C12Q2535/122C12Q2565/301
Inventor 杨小丽甘翔李洪涛李周全李佳桐檀燕君
Owner 杨小丽
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More