GBSSI mutant protein based on gene editing technology and application thereof in plant breeding
A gene editing and mutation technology, which can be applied in applications, plant products, genetic engineering, etc., can solve problems such as laboriousness, affecting Wx gene activity, and many uncertain factors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: The process of obtaining the rice mutant waxy-m with about 5% amylose content
[0040] 1. Selection of CRISPR / Cas9 modified targets
[0041] Scanning the whole genome sequence of Waxy, the Waxy gene has 13 exons in total. According to existing research, it is known that Waxy single-base mutation sites are mainly concentrated in exons 4-6. Based on this, we limited the selection of mutation sites to On the 4th exon, the 4th exon was screened with the help of CRISPR-GE (http: / / skl.scau.edu.cn) and CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR) websites The targeting sequence on the exon: AAGACCGGTGAGAAGATCTA (SEQ ID NO.5), located at bases 10-29 in the 4th exon.
[0042] 2. CRISPR / Cas9 vector construction
[0043] The following oligonucleotides were synthesized for this targeting sequence: sgRNA-Waxy-F: 5'-TGTGTGAGACCGGTGAGAAGATCTA-3' (SEQ ID NO.6); sgRNA-Waxy-R: 5'-AAACTAGATCTTCTCACCGGTCTCA-3' (SEQ ID NO.7); Dissolve the synthesized primers sgRNA-Waxy-F and sg...
Embodiment 2
[0046] Example 2: Cloning of the rice mutant Waxy-m gene with an amylose content of about 5%
[0047] The leaves of the T1 generation individual plants of the homozygous mutant plants in the above-mentioned Example 1 were taken respectively, and genomic DNA was extracted, and PCR amplification was performed with specific primers Waxy-F and Waxy-R for the full length of the Waxy gene. Amplified products were sequenced. The sequencing results were compared with the Xiushui 134 wild-type Waxy gene (the nucleic acid sequence is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4), and it was found that the 849th and 850th positions C of the gene were mutated to T. The fusion mutation is the same as that of the T0 generation plants. Further analysis shows that the mutation of this site of the Waxy gene leads to the mutation of the GBSSI protein sequence and the 178th amino acid of Xiushui 134GBSSI protein from threonine to isoleucine, such as image 3 shown. ...
Embodiment 3
[0050] Embodiment 3 Removes the acquisition of the stable mutant plant of T-DNA carrier
[0051] The vector for directed editing of the Waxy gene constructed by the present invention contains a T-DNA vector. The T-DNA involved in the present invention mainly includes the selection marker HPT gene and the Cas9 element. Due to the main functions of the hygromycin phosphotransferase HPT gene and the Cas9 element It is used for the screening of transformed positive plants and the completion of site-directed mutation of the target gene, and these two genes are foreign genes relative to the rice genome, and HPT is an antibiotic selection marker that needs to be eliminated. If the Cas9 element is retained in the plant It is possible to continue editing the mutation site to generate other Waxy alleles, and the random insertion of T-DNA may also cause unexpected gene mutations, so it needs to be cleared after the gene editing task is completed. Through Agrobacterium-mediated transforma...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com