Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of indel molecular marker and its application for identifying the seed purity of muskmelon Niuhuahua varieties

A molecular marker, niuhuahua technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc. Accelerate the speed and accuracy of identification, ensure the purity and quality of seeds, and the effect of rapid identification

Active Publication Date: 2022-04-15
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has many disadvantages, such as heavy workload, long period, phenotype is easily affected by the environment, etc., and the phenotypic identification method requires the identification personnel to be very familiar with the phenotypic differences between the variety and its parents. relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of indel molecular marker and its application for identifying the seed purity of muskmelon Niuhuahua varieties
  • A kind of indel molecular marker and its application for identifying the seed purity of muskmelon Niuhuahua varieties
  • A kind of indel molecular marker and its application for identifying the seed purity of muskmelon Niuhuahua varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Screening of Molecular Markers

[0026] The male parent 14500 (short stick type, gray-green peel with dark green spots, light red flesh, crisp and sweet flesh) and female parent 14503 (horn-shaped, gray-green peel, green flesh, crisp and sweet, good fruit setting) were resequenced According to the results of sequencing comparison, 150 pairs of InDel markers were designed, among which there were 13 pairs of polymorphic markers in the male and female parents, and 8 pairs of markers with clear bands were selected (primer sequences are shown in Table 1) in 198 cattle strains. Seed purity verification was carried out in the Huahua variety, and the results are shown in Table 2. Only the marker C46 had an accuracy rate of 100%. The male parent identified with marker C46 has a 219bp characteristic band, the female parent has a 253bp characteristic band, and the hybrid seeds have both the male and female parent's characteristic bands (see figure 1 . )

[0027] Tabl...

Embodiment 2

[0032] Example 2: Application of Molecular Markers

[0033] The specific operation steps of InDel molecular markers to identify the purity of the seeds of the muskmelon Niuhua flower variety are as follows:

[0034] (1) Extract the DNA of the species to be tested and its parents

[0035] After the melon seeds to be tested are germinated, they are placed in a hole tray to germinate and emerge. When the seedlings grow until the cotyledons are flattened, take 3cm 2 Put the cotyledons in a 2ml centrifuge tube, freeze them quickly with liquid nitrogen, grind them to powder, add 800 μl CTAB buffer, mix well, and put them in a water bath at 65°C for 1 hour. uniform);

[0036] Add 800 μl of chloroform / isoamyl alcohol mixture (24:1), shake on a shaker for 5 minutes, and centrifuge at 12,000 rpm for 10 minutes; draw 450 μl of supernatant into a 2ml centrifuge tube, and repeat the above operation once;

[0037] Pipette 450 μl of supernatant into a 1.5ml centrifuge tube, add 450 μl of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an InDel marker for identifying the purity of the seeds of a muskmelon oxflower variety and an application thereof. The sequence of the marker is as follows: C46‑F: TTGGTGCAACTCCTCCAACT, C46‑R: GCCCAACCACGTGACATTAT, the marker has the specific amplification products of male parent 14500 and female parent 14503 in the first generation of hybrids. Using this marker to test the samples of Niuhuahua cultivar, the purity result of the inspection is completely consistent with the purity result of field planting identification, indicating that this marker can be used to quickly detect the seed purity of Niuhuahua melon variety.

Description

technical field [0001] The invention belongs to the field of molecular biotechnology assisted breeding, and relates to an InDel molecular marker for identifying the purity of seeds of muskmelon oxflower varieties and an application thereof. Background technique [0002] Melon belongs to Cucurbitaceae Melon is an annual vine herb. Niuhuahua is a variety with excellent field agronomic characters. This variety is obtained through hybrid seed production, and the female parent needs to be detasselled manually before pollen is given to the male parent. However, if the female parent is not completely detasselled or emasculated, false hybrids will be produced, which will seriously affect the purity of the seed production. [0003] The traditional method of identifying the purity of melon hybrid seeds is mainly to observe the field morphology of the plants through field planting, and calculate the seed purity based on this. However, this method has many disadvantages, such as heavy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
Inventor 付秋实王怀松胡志程
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com