Composition and diagnostic reagent for detecting high-grade cervical lesions and cervical cancer
A diagnostic reagent and composition technology, applied in the field of internal reference gene primers, can solve problems such as insufficient correlation of cervical cancer, achieve simple and accurate risk classification methods, and improve the effect of predictive ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 Preparation of diagnostic reagents for cervical high-grade lesions and cervical cancer detection according to the present invention 1. Design and synthesis of primers and probes
[0058] For human EPB41L3 425, 427, 438 sites and the internal reference gene ACTB (for the sequence, refer to the human genome sequence NC_00018.10 published by the NCBI database), and for the viral HPV 16L1 gene 6367, 6389 sites (for the sequence, see AF125673.1 published by the NCBI database) and the HPV18L2 gene Sites 4256, 4261, 4265, 4269, 4275, and 4282 (for the sequence, see AY262282.1 published in the NCBI database), specific primers and probes were designed using Primer Premier 5.0 and Methy Primer Express v1.0 software, respectively.
[0059] Specific primers and probe sequences are shown in the table below:
[0060] sequence name oligonucleotide sequence base length EPB41L3 forward primer TAAATTGGCGGAGAAGGGAC 20 EPB41L3 reverse primer GGTTTTTTT...
Embodiment 2
[0081] Example 2: Detection of cervical cancer methylation using the reagent of Example 1
[0082] 1. Technical principle
[0083] After extracting and purifying the DNA of cervical exfoliated cells, the DNA needs to be treated with bisulfite. After the treatment, the C base on the CpG island that has undergone methylation in the DNA remains as a C base without methylation. The C base on the converted CpG island becomes a U base, which causes the sequence difference between methylated DNA and unmethylated DNA, which can be used to detect methylation for subsequent methylation detection methods level, such as figure 1 shown.
[0084] The methylated target genes EPB41L3, HPV16L1 and HPV18L2 were detected by methylation-specific fluorescent quantitative PCR method. Firstly, methylation-specific primers were used to amplify the nucleic acid, and multi-channel probe fluorescent labeling was used to realize the detection of 3 Real-time fluorescence detection was carried out for e...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com