Primer, kit and detection method used for detecting insect cell DNA residues
A technology of insect cells and kits, applied in the biological field, can solve the problem of no rapid quantitative detection kits for DNA residues in insect cells, and achieve reliable quality detection data, good sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1.1 Materials and reagents
[0036] 2×Taq PCR master mix was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0037] 2 × Taqman Master Mix premix, purchased from Tianjin Kebaidi Biomedical Technology Co., Ltd.;
[0038] ABI7500 fluorescent quantitative PCR instrument, purchased from ABI (Applied Biosystems, USA);
[0039] The DNA diluent is prepared by the laboratory using molecular biology grade reagents;
[0040] Genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0041] The primers and probes used in the experiment were synthesized and purified by Invitrogen American Yingjie Life Technology Co., Ltd.
[0042] The primer and probe sequences used are as follows:
[0043] Forward primer sequence: 5'- CGCTGTAAGAGGACCGTAG -3' (Seq ID No:1)
[0044] Reverse primer sequence: 5'- GACCTCACGCAATCTTCTGA -3' (Seq ID No:2)
[0045] Taqman probe: 5'- ACCGCTGCCTCCTCCTGCAGG -3' (Seq ID No:3)
[0046] The fluo...
Embodiment 2
[0068] Embodiment 2: the preparation of kit
[0069] The preparation of the kit includes the following components:
[0070] Insect cell genomic DNA (30ng / ul) (40ul / tube) 1 tube, DNA diluent (7ml / bottle) 1 bottle, 2×TaqmanMaster Mix (1500ul / tube) 1 tube, 10×primer-probe mixture (300ul / tube ) 1 tube, ultrapure water (1.5ml / tube) 1 tube.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com