Kit for detecting onset risk of low-grade non-muscular invasive bladder cancer
An invasive, low-grade technology, applied in the field of kits for detecting the risk of low-grade non-muscle invasive bladder cancer, can solve the problems of high price of sequencing technology, and achieve a short detection cycle, simple operation, and reliable prediction. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] A kit for detecting the risk of developing low-grade non-muscle-invasive bladder cancer, comprising:
[0029] (1) A fluorescently labeled probe that specifically recognizes the mutation at the rs907611 site of the LSP1 gene promoter, the nucleotide sequences of its universal probe and differential probe are as follows:
[0030] Universal probe for rs907611: -P-CCATCTTGGCCCTCGCACCCCGTCT-FAM- (SEQ ID NO 1)
[0031] Differential probe A sequence of rs907611: CCGAGCCATGAAGAGCTGCCTGCGA (SEQ ID NO 2)
[0032] Difference probe G sequence of rs907611: TTTCCGAGCCATGAAGAGCTGCCTGCGG (SEQ ID NO 3)
[0033] (2) Specific primers for detecting the rs907611 site mutation of the LSP1 gene promoter, the nucleotide sequence is as follows:
[0034] Upstream primer: 5'-CCCAAAGAAGCTAAAACGCTC-3' (SEQ ID NO 4);
[0035] Downstream primer: 5'-AGCGTTAAGCAAGTTACAGGG-3' (SEQ ID NO 5);
[0036] (3) Master Mix, which includes: 1×PCR buffer, 0.2μM dNTPs, 40U / ul one Taq DNA polymerase and 10ng DNA...
Embodiment 2
[0039] Utilize the kit of embodiment 1 to detect LSP1 gene promoter mutation, comprise the following steps:
[0040] (1) Extract the blood of the sample to be tested (the venous blood of the Chinese Han population), extract the genomic DNA of the cells by the phenol method, and the genomic DNA of the extracted sample is quantified at about 1ng / ul-10ng / ul.
[0041] (2) PCR amplification
[0042] PCR reaction system
[0043]
[0044] Amplification conditions:
[0045]
[0046] (3) Connection reaction:
[0047]
[0048]
[0049] Connection conditions: 94°C 30s
[0050] 56℃ 3min 30cycles
[0051](4) Take 1ul extension product, add 8ul loading sample, denature at 95°C for 3min, immediately put it in ice-water bath, put it on the sequencer, and obtain the typing result (such as figure 1 shown).
[0052] The templates and primers required for the experiment are as follows:
[0053] Upstream primer: 5'-CCCAAAGAAGCTAAAACGCTC-3' (SEQ ID NO 4);
[0054] Downstream pri...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com