Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RPA primer, probe and kit for detecting TiLV of tilapia

A tilapia and kit technology, applied in the fields of DNA/RNA fragments, microorganisms, recombinant DNA technology, etc., can solve problems such as the lack of effective prevention and treatment of TiLV, and achieve the effect of high accuracy and simple operation.

Pending Publication Date: 2020-07-03
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no effective prevention and treatment technology for TiLV in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA primer, probe and kit for detecting TiLV of tilapia
  • RPA primer, probe and kit for detecting TiLV of tilapia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Designing RPA primers and probe structures based on the ORF10 gene of Luohu virus

[0024] (1) The sequence of TiLV-ORF10 is, as shown in sequence 4:

[0025] GCAAATCTTTCCCTCTGACACCCTGTATAGTTAGCGTTGGCCTGTGGATACGAACGAAATCAGAACCGATATTAAGGTGCTAAGACTGCACGTCAAGAGACTTCTTTCCGAAATCTTCGGAAAATCGAGATAGGTCACTCTGCCCATCATCCTCTCTGTCCCTTCTGTTTTTGGGATTGAAATCAACCCTAGCCCACTCTGGGATTGCAGAATCACAGTCGTCCATCTCGAGGTCGACTTCGTCACCCCACTCTATATTATCTTCACCGCTCTCGTCAGCACCATACCTTTCATTCTTCCAACTTCGCTTCTTTGAAGCAGCTTTCTTGCCCTTCTTGATCTTCCGACTTCTTAGTACTAAACATCCTGAGCTCTCAGCCCCCGAGTCACTGTCACTTGACAAATAATCTGCCACACTCATCCTGGCTTATAGCTATATTTGGTGTTAGTAGGGTTAAAATTTGG。

[0026] (2) As shown in sequences 1 and 2, the nucleotide sequence of the RPA primer is:

[0027] Upstream primer ORF10-F: 5'-TTTCCCTCTGACACCCTGTATAGTTAGCGT-3';

[0028] Downstream primer ORF10-R: 5'-AACCCTACTAACACCAAATATAGCTATAAGC-3'.

[0029] (3) As shown in sequence 3, the probe structure is designed based on the ORF10 gene of Luohu virus,...

Embodiment 2

[0032] Embodiment 2: A kind of RPA kit and using method for detecting Tilapia TiLV

[0033] (1) The kit includes the RPA reaction amplification system: a total of 50 μL, 4 μL of upstream primer ORF10-F, 4 μL of downstream primer ORF10-R, 2 μL of probe P, 200 ng of nucleic acid template, and rehydration buffer (Rehydration Buffer) 29.5 μL, 2.5 μL magnesium acetate solution (280 mmol / L), and deionized water as the balance.

[0034] (2) The method of use is as follows:

[0035] S1, extracting the total RNA and cDNA synthesis of the virus to be tested.

[0036] S2, RPA amplification reaction.

[0037] The reaction system is as follows: the total amount is 50 μL, add 4 μL upstream primer ORF10-F, 4 μL downstream primer ORF10-R, 2 μL Probe P, 200 ng of nucleic acid template, 29.5 μL of rehydration buffer (Rehydration Buffer), 2.5 μL of magnesium acetate solution (280 mmol / L), and deionized water as the balance.

[0038] Mix the RPA amplification system well, centrifuge at 5,000×...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinase polymerase amplification (RPA) primer, probe and kit for detecting TiLV of tilapia, and relates to the technical field of biology. The technical scheme is characterized in that the specific RPA primer, probe and kit are designed for the ORF10 gene of tilapia lake virus (TiLV) of tilapia, so that accurate qualitative detection can be performed on the tilapia lake virus of tilapia. Based on the RPA amplification primer, the probe and the kit, accuracy is high, operation is simple and rapid, and scientific guiding significance is achieved on culture and import and export inspection and quarantine of tilapia.

Description

technical field [0001] The invention relates to the field of biotechnology, more specifically, it relates to an RPA primer, a probe and a kit for detecting tilapia TiLV. Background technique [0002] Tilapia is one of the most important freshwater aquaculture economic fish species in the world. It can be cultured at high density and is an important source of animal protein in developing countries. Tilapia is native to Africa and is a tropical fish. There are more than 100 species of Tilapia including subspecies. Tilapia has the characteristics of fast growth, high yield, miscellaneous food habits and strong fecundity. At present, the cultivation of tilapia in my country is mainly concentrated in tropical and subtropical regions such as Guangdong, Guangxi, and Hainan, mainly in ponds. In addition to domestic sales, tilapia can also be made into fish fillets and fish steaks for export abroad. It is one of the important sources of income for fishermen in southern my country. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6844C12Q2521/507C12Q2565/125
Inventor 余乃通刘志昕陈中元
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com