Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

PCR primer set and kit for detection of Pepper vein mottle viruses (PVMV) and application of PCR primer set and kit

A technology of sweet pepper leaf veins and mottled viruses, which is applied in the direction of recombinant DNA technology, biochemical equipment and methods, and microbial measurement/inspection, can solve the problem of low sensitivity and specificity, failure to rule out false negatives, and inaccurate detection results and other problems to achieve the effect of avoiding false positives, avoiding false negative results, and high sensitivity

Active Publication Date: 2020-05-08
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the defects of two common detection methods for PVMV detection in the prior art: one is that the sensitivity and specificity of the serological detection method are not high, and non-specificity is prone to occur and cause false positive results; the other is that the RT-PCR method only uses A pair of specific primers for PVMV detection cannot rule out false negatives, and even false positives, resulting in technical problems that the detection results are not accurate enough. A PCR primer set for accurate detection of PVMV is provided, which can be used for pepper pathogenic plants from different regions. PVMV nuclear inclusion body protein b (Nuclear Inclusion body'b'protein, NIb) coding gene was sequenced, and 3 specific primers were designed from the conserved region to form 2 pairs of primers, which can improve the specificity of PVMV detection and at the same time To eliminate the effect of false positive amplification, add a pair of specific primers designed for the actin gene (Actin) of solanaceous plants as an internal reference, which can detect the quality of cDNA synthesis and play a role in eliminating false negative amplification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer set and kit for detection of Pepper vein mottle viruses (PVMV) and application of PCR primer set and kit
  • PCR primer set and kit for detection of Pepper vein mottle viruses (PVMV) and application of PCR primer set and kit
  • PCR primer set and kit for detection of Pepper vein mottle viruses (PVMV) and application of PCR primer set and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A PCR primer set for detecting sweet pepper vein mottle virus (PVMV), including 3 specific primers for nuclear inclusion body protein b gene (NIb) of sweet pepper vein mottle virus (PVMV) and 2 specific primers for Actin, an internal reference gene of solanaceous plants, wherein The three specific primers for nuclear inclusion body protein b gene (NIb) of sweet pepper vein mottle virus were PVMV-F1, PVMV-F310 and PVMV-R824, and the two specific primers for internal reference gene Actin of solanaceous plants were PeActin-F1 and PeActin -R1093, as follows:

[0033] PVMV-F1: AGGTGTGTAAATGATTTCGGC, as shown in SEQ ID NO.1;

[0034] PVMV-F310: TGTGAATGTCCTCGTCTTG, as shown in SEQ ID NO.2;

[0035] PVMV-R824: GAAAAAGTGAGAGCCAGTTAGT, as shown in SEQ ID NO.3;

[0036]PeActin-F1:GTGACAATGGAACAGGAATG, as shown in SEQ ID NO.4;

[0037] PeActin-R1093:CACTTCCGGTGGACAATG, as shown in SEQ ID NO.5.

[0038] Adopt the above-mentioned primer set to be used for detecting the PCR detec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR primer set for detection of Pepper vein mottle viruses (PVMV). The PCR primer set includes three nuclear inclusion protein b gene (NIb) specific primers of the Pepper vein mottle viruses and two reference gene Actin specific primers of solanaceous plants, wherein the three nuclear inclusion protein b gene (NIb) specific primers of the Pepper vein mottle viruses are PVMV-F1, PVMV-F310 and PVMV-R824, and the two reference gene Actin specific primers of solanaceous plants are PeActin-F1 and PeActin-R1093. Detection of PCR amplification results is performed in 1.0%-1.5% of agarose, no expensive fluorescent quantitative PCR instruments are needed, and the primer set has the characteristics of a high speed, economy, high stability, high accuracy and high sensitivity.

Description

technical field [0001] The invention belongs to the technical field of crop virus detection, and in particular relates to a PCR primer set, a kit and an application thereof for detecting sweet pepper vein mottle virus (PVMV). Background technique [0002] Pepper vein mottle virus (PVMV) belongs to the genus Potyvirus. The virus genome is a positive-sense single-stranded RNA with a size of about 9.8 kb. The 5' end is covalently bound to the VPg protein, and the 3' end has a Poly(A) tail structure. The virus can infect at least 35 different species of Solanaceae by rubbing inoculation, and can also infect plants in the Chenopodiaceae, Amaranthaceae, Rutaceae, and Cucurbitaceae. The symptoms of different PVMV strains infecting different hosts are different. The virus can cause yellowing of pepper leaves, distortion of leaf veins, chlorosis between veins, and even smaller and deformed leaves and fruits, and cause a large amount of yield reduction. The PVMV virus originated in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686
Inventor 龚明霞王日升王萌赵虎吴星赵曾菁何志黄金梅
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products