Klebsiella oxytoca for expressing luciferase and application of klebsiella oxytoca
A Klebsiella oxytoca, luciferase gene technology, applied in the directions of enzymes, enzymes, applications, etc., can solve the problems of cumbersome production process, in-depth research on infection prevention and control, unstable competence efficiency, etc., and achieves easy operation. Easy to obtain, prevent nosocomial infection, and improve the effect of connection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1 Contains the construction of the pan-host plasmid of luciferase gene
[0054] 1. LUXA / B / C / D / E gene cluster amplification:
[0055] (1), design the primer pair of LUX gene cluster
[0056] LUX F: GATTCAATTGTGAGCGGATAAC (SEQ ID NO. 1);
[0057] LUX R: ATTTGTCCTACTCAGGAGAG (SEQ ID NO. 2).
[0058] The lowercase bold sequence in the primer is the complementary sequence between this sequence and pBBR1.
[0059] The length of the pBAV1k-T5-LUX plasmid is 10546bp, and its lux A / B / C / D / E gene cluster is controlled by the T5 promoter, with a total of 5663bp. We use Q5 high-fidelity DNA polymerase and a primer pair containing the LUX gene cluster. During the design process, the same sequence as pBBR1 was added ( figure 1 Shown in A), amplify the LUX A / B / C / D / E group of pBAV1k-T5-LUX plasmid.
[0060] (2), LUX A / B / C / D / E gene cluster PCR amplification
[0061] Table 1: LUX A / B / C / D / E Gene Cluster Amplification PCR Reaction System
[0062]
[0063] After conf...
Embodiment 2
[0086] Example 2 Detection of Klebsiella oxytocin luciferin gene expression containing luciferase
[0087] 1. Preparation of Klebsiella oxytoca competent for electroporation
[0088] A single colony of Klebsiella oxytoca was picked and inoculated in liquid BHI medium, and cultured overnight at 37°C. Take the Klebsiella oxytoca cultured overnight and inoculate it into fresh BHI medium at a ratio of 1:10, and culture it statically at 37°C until OD 600 = 0.3 to 0.4. Take out the bacterial liquid in the logarithmic phase, after 30min in ice bath, centrifuge at 4°C and 4000rcf to collect the bacterial cells, wash the bacterial cells with pre-cooled sterile double distilled water and pre-cooled 1% sucrose solution respectively, and then the acid-producing grams Lebsiella competent cells.
[0089] 2. Electrotransformation of pBBR1-LUX A / B / C / D / E plasmids:
[0090] Take 5 μl of pBBR1-LUX A / B / C / D / E plasmid and add it to 100 μl of Klebsiella oxytoca competent cells, mix well and ice-ba...
Embodiment 3
[0094] Example 3: Detection of luciferase intensity at different concentrations of KOX-D1 / pBBR1-LUX A / B / C / D / E
[0095] Pick KOX-D1 / pBBR1-LUX A / B / C / D / E single colony strains and culture them at 37°C for 4 hours, then use the NanoDropTM One ultra-micro-volume ultraviolet spectrophotometer to detect the bacterial OD value. Based on 1OD=10 9 Bacterial concentration was calculated from colony-forming unit (Cfu). The obtained strain was diluted 6 gradients according to 1:10, and the Luminesence value was detected on a microplate reader, and the results were as follows: Figure 5 As shown, the Luminesence value decreases with the decrease of the colony concentration, when the strain concentration is 10 6 Cfu and 10 5 At Cfu, the fluorescence intensities are 5869±215.9 and 660.2±215.9 respectively, lower than 10 5 When Cfu, its fluorescence cannot be detected in the small animal imager, therefore, when recommending that this bacterium is used for animal experiments, the enrichment...
PUM
Property | Measurement | Unit |
---|---|---|
electrical resistance | aaaaa | aaaaa |
fluorescence | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com