Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-ANGPTL3 (angiopoietin-like protein) monoclonal antibody and purpose thereof in preparing medicine capable of treating nephrotic syndrome

A monoclonal antibody, nephrotic syndrome technology, applied in the field of preparation of nephrotic syndrome drugs, anti-ANGPTL3 monoclonal antibody, can solve the problem of no functional antibody and so on

Active Publication Date: 2020-03-31
CHILDRENS HOSPITAL OF FUDAN UNIV
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the monoclonal antibody against ANGPTL3 is only used for Western-Blot, ELISA and other experimental detections, and there is no functional antibody against the functional domain of ANGPTL3

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-ANGPTL3 (angiopoietin-like protein) monoclonal antibody and purpose thereof in preparing medicine capable of treating nephrotic syndrome
  • Anti-ANGPTL3 (angiopoietin-like protein) monoclonal antibody and purpose thereof in preparing medicine capable of treating nephrotic syndrome
  • Anti-ANGPTL3 (angiopoietin-like protein) monoclonal antibody and purpose thereof in preparing medicine capable of treating nephrotic syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0021] The present invention uses the following reagents, cells, antibodies:

[0022]

[0023] The above reagents, cells, and antibodies are all commercially available products from Genescript Biotechnology Co., Ltd.

[0024] 1. Sequence of monoclonal antibody

[0025] An anti-ANGPTL3 monoclonal antibody of the present invention, the heavy chain DNA sequence (1392bp) (SEQ ID: No 3) is as follows:

[0026] ATGGCTGTCCTGGCACTGCTCCTCTGCCTGGTGACATTCCCAAGCTGTGTCCTGTCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCACCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAACACAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCCAAGTTTTCTTAAAACTGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCAAAGGAGGACCCTATGGTAACTACGTGCCCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGCCAAAACGACACCCCCATCTGTCTATCCACTGGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-ANGPTL3 (angiopoietin-like protein) monoclonal antibody. The heavy chain amino acid sequence of the monoclonal antibody is SEQ ID: No 1, the light chain amino acid sequence of the monoclonal antibody is SEQ ID: No 2, the heavy chain DNA (deoxyribonucleic acid) sequence of the monoclonal antibody is SEQ ID: No 3, and the light chain DNA sequence of the monoclonal antibody is SEQ ID: No 4. The invention also discloses application of the anti-ANGPTL3 monoclonal antibody in preparing a medicine capable of treating a nephrotic syndrome. The anti-ANGPTL3 monoclonal antibody specifically identifies an ANGPTL3, blocks a fibrinogen-like structural domain of the ANGPTL3, and antagonizes the injury of the ANGPTL3 to sertoli cells. The invention can be used for detecting the ANGPTL3 and is hopefully used for treating nephrotic syndrome proteinuria.

Description

technical field [0001] The invention relates to the field of monoclonal antibodies, in particular to an anti-ANGPTL3 monoclonal antibody and its use in the preparation of medicines for treating nephrotic syndrome. Background technique [0002] Proteinuria is a common clinical manifestation of kidney disease, which is mainly related to the damage of renal podocytes. At present, there is a lack of specific treatment methods for pathogenic factors. [0003] Angiopoietin-like protein 3 (ANGPTL3) is a secreted glycoprotein that contains a coiled-coil domain (CCD) and a fibrinogen-like domain (FLD). CCD can inhibit lipoprotein esterase, Regulates lipid metabolism, and FLD binds to the receptor integrin ανβ3 to participate in podocyte injury. [0004] Currently, monoclonal antibodies against ANGPTL3 are only used for Western-Blot, ELISA and other experimental detections, and there is no functional antibody against the functional domain of ANGPTL3. Contents of the invention [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/22A61K39/395A61P13/12
CPCC07K16/22A61P13/12C07K2319/72A61K2039/505
Inventor 徐虹韩新利沈茜孙利刘海梅吕倩影
Owner CHILDRENS HOSPITAL OF FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com