Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An anti-angptl3 monoclonal antibody and its use in the preparation of a medicine for treating nephrotic syndrome

A monoclonal antibody and nephrotic syndrome technology, which is applied in the field of anti-ANGPTL3 monoclonal antibody and the preparation of drugs for the treatment of nephrotic syndrome, can solve the problem of no functional antibody and achieve the effect of protecting podocytes

Active Publication Date: 2022-07-26
CHILDRENS HOSPITAL OF FUDAN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the monoclonal antibody against ANGPTL3 is only used for Western-Blot, ELISA and other experimental detections, and there is no functional antibody against the functional domain of ANGPTL3

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An anti-angptl3 monoclonal antibody and its use in the preparation of a medicine for treating nephrotic syndrome
  • An anti-angptl3 monoclonal antibody and its use in the preparation of a medicine for treating nephrotic syndrome
  • An anti-angptl3 monoclonal antibody and its use in the preparation of a medicine for treating nephrotic syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0021] The present invention uses the following reagents, cells and antibodies:

[0022]

[0023] The above reagents, cells, and antibodies are all commercially available products from Genescript Biotechnology Co., Ltd.

[0024] The sequence of the monoclonal antibody

[0025] A kind of anti-ANGPTL3 monoclonal antibody of the present invention, heavy chain DNA sequence (1392bp) (SEQ ID:No 3) is as follows:

[0026] ATGGCTGTCCTGGCACTGCTCCTCTGCCTGGTGACATTCCCAAGCTGTGTCCTGTCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCACCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAACACAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCCAAGTTTTCTTAAAACTGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCAAAGGAGGACCCTATGGTAACTACGTGCCCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGCCAAAACGACACCCCCATCTGTCTAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-ANGPTL3 monoclonal antibody, the heavy chain amino acid sequence of the monoclonal antibody is SEQ ID: No 1, the light chain amino acid sequence is SEQ ID: No 2; the heavy chain DNA sequence is SEQ ID: No 3 , the light chain DNA sequence is SEQ ID:No 4. The application of the anti-ANGPTL3 monoclonal antibody of the present invention in preparing a medicine for treating nephrotic syndrome, the anti-ANGPTL3 monoclonal antibody specifically recognizes ANGPTL3, blocks the fibrinogen-like domain of ANGPTL3, and antagonizes the damage of ANGPTL3 to podocytes. The invention can be applied to detect ANGPTL3, and is expected to be used for the treatment of proteinuria in nephrotic syndrome.

Description

technical field [0001] The invention relates to the field of monoclonal antibodies, in particular to an anti-ANGPTL3 monoclonal antibody and its use in preparing a medicine for treating nephrotic syndrome. Background technique [0002] Proteinuria is a common clinical manifestation of renal disease, which is mainly related to renal podocyte damage. Currently, there is no specific treatment for the pathogenic factors. [0003] Angiopoietin-like protein 3 (ANGPTL3) is a secreted glycoprotein containing a coiled-coil-like domain (CCD) and a fibrinogen-like domain (FLD). CCD inhibits lipoprotein lipase, Regulating lipid metabolism, FLD is involved in podocyte injury by binding to the receptor integrin αvβ3. [0004] At present, the monoclonal antibody against ANGPTL3 is only used for Western-Blot, ELISA and other experimental detection, and there is no functional antibody against the functional domain of ANGPTL3. SUMMARY OF THE INVENTION [0005] The present invention provid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/22A61K39/395A61P13/12
CPCC07K16/22A61P13/12C07K2319/72A61K2039/505
Inventor 徐虹韩新利沈茜孙利刘海梅吕倩影
Owner CHILDRENS HOSPITAL OF FUDAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More