Oligonucleotide, method and kit for detecting relative expression of MLL5 gene in sample
A technology of relative expression and oligonucleotides, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., can solve the problems of high cost and poor specificity, and achieve easy operation and predictive The effect of prognosis and improving experimental efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The nucleic acid detection kit used to detect the relative expression of MLL5 in samples can be used to assist in the early prevention, early diagnosis and auxiliary indicators of prognosis of human tumors in clinical practice, and can also perform more accurate screening for high-risk groups. The kit includes: sample extraction reagent; RNA reverse transcription reagent: ReverTra Ace qPCR RT Kit (TOYOBO); detection system PCR reaction solution; positive control, negative control and blank control.
[0043] Wherein, the sample extraction reagent can extract RNA in tissue or blood. Sample extraction reagents and RNA reverse transcription reagents can be prepared by themselves, or purchased from commercial reagents such as related kits from TOYOBO.
[0044] Detection system PCR reaction solution: THNDERBIRD Probe qPCR Mix (2×), MLL5-F, MLL5-R, MLL5-Probe, ABL-F, ABL-R, ABL-Probe; the primer and probe sequences are:
[0045] MLL5-F: CCTTTACCAACACCAGCTACAG
[0046] MLL5-R...
Embodiment 2
[0053] 1. Sample blood total RNA extraction process:
[0054] (1) Collect 1ml of anticoagulated fresh blood, and register age and gender;
[0055] (2) Add 1ml of erythrocyte lysate into a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Stand at room temperature for 10 minutes;
[0056] (3) Centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom;
[0057] (4) Add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom;
[0058] (5) Add 0.2ml TRIzol to the cells, pipette repeatedly until the precipitate is completely dissolved, mix 5 tubes of TRIzol digestion solution into 1 tube, and let stand at room temperature for 5 minutes;
[0059] (6) Add 0.2ml chloroform and shake evenly;
[0060] (7) Centrifuge at 14000rpm at 4°C for 10min, absorb the supernatant layer and transfer it to another new centrifuge tube (do not absorb the white middle...
Embodiment 4
[0077] The detection kit of the invention is used to detect normal people and blood samples.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap