Supercharge Your Innovation With Domain-Expert AI Agents!

Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application

A point mutation and methylation technology, which can be used in biochemical equipment and methods, DNA/RNA fragments, determination/inspection of microorganisms, etc. rate, etc.

Active Publication Date: 2019-12-31
HUNAN YEARTH BIOTECHNOLOGICAL CO LTD
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above-mentioned traditional bladder cancer examination methods cannot meet the requirements of non-invasiveness and high detection rate at the same time.
[0004] Although molecular diagnostic methods can be used clinically to diagnose bladder cancer, they all use a single detection method, such as only for relevant biological information such as gene methylation or single site mutation.
The accuracy and sensitivity of its detection rate are still unsatisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application
  • Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application
  • Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation of Urinary Bladder Cancer Driver Gene Point Mutation Methylation Combined Auxiliary Diagnostic Kit

[0030] 1. Primer probe design

[0031] 1) Driver gene point mutation targets and primers and probes

[0032] FGFR3 exon7

[0033] GTGCTGGGTGAGGGCCCTGGGGCGGCGCGGGGGTGGGGGCGGCAGTGGCGGTGGTGGTGAGGGAGGGGGTGGCCCCTGAGCGTCATCTGCCCCCACAGAGCGCT[C]CCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACCAGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGACGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGA(SEQ ID NO:1)

[0034] c.746C>G

[0035] After heavy salt conversion:

[0036] GTGTTGGGTGAGGGTTTTGGGGCGGCGCGGGGGTGGGGGCGGTAGTGGCGGTGGTGGTGAGGGAGGGGGTGGTTTTTGAGCGTTATTTGTTTTTATAGAGCGTT[T]TTCGTATCGGTTTATTTTGTAGGCGGGGTTGTCGGTTAATTAGACGGCGGTGTTGGGTAGCGACGTGGAGTTTTATTGTAAGGTGTATAGTGACGTATAGTTTTATATTTAGTGGTTTAAGTACGTGGA

[0037] FGFR3-ARMS-F1:GAGCGTTATTTGTTTTTAGAGCGTTG (SEQ ID NO: 7)

[0038] FGFR3-ARMS-F2:TTGAGCGTTATTTGTTTTTAGAGCGTTGT (SEQ ID NO: 8)

[0039] FGFR3-ARMS-F3:GAGCGTTATTTGTTTTT...

Embodiment 2

[0111] Example 2 Optimization of primers and probes for urine bladder cancer driver gene point mutation methylation joint auxiliary diagnostic kit Screen and optimize the primer combination and primer concentration for point mutations, and perform primer set screening and concentration optimization tests according to the following table

[0112]

[0113]

[0114] The combination screening and concentration optimization of methylated primer probes are performed according to the following table:

[0115]

[0116]

[0117] According to Example 1, formula reaction system, using point mutation positive quality control, methylation positive quality control, negative quality control as the system test template, respectively for the primer combination and concentration test detection of the primer probe in the above table .

[0118] Test Results:

[0119] Primer probe combination specificity test results:

[0120]

[0121]

[0122]

[0123]

[0124] Compariso...

Embodiment 3

[0132] Example 3 Urinary Bladder Cancer Driver Gene Point Mutation Methylation Combined with Auxiliary Diagnostic Kit Detection Reaction Enzyme and Detection Procedure Optimization

[0133] Point mutation positive quality control, methylation positive quality control, and negative quality control are detection templates (10 replicates)

[0134] According to the optimization test of detection reaction enzyme and detection program according to the following table respectively:

[0135]

[0136]

[0137] The standard qPCR detection procedure is composed of the first stage, the third stage and the fourth stage in Example 1.

[0138] Test Results:

[0139]

[0140] To sum up, the optimal reaction enzyme system is Glod 360Master MIX.

[0141]

[0142] In summary, the optimal reaction detection procedure is the detection procedure of the present invention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method, reagent kit and system for screening, or detection or auxiliary diagnose of bladder cancer, and an application. FGFR3, TERT and PLEKHS1 point mutation and OTX1, NID2 and NRN1 methylation level can be detected at the same time, united detection of gene point mutation and methylation detection can be skillfully realized, the requirement quantity of samples, the experiment operation steps and the detection period can be reduced, and the detection specificity and the detection sensitivity are improved.

Description

technical field [0001] The invention belongs to the technical field of gene variation detection, and in particular relates to a method for simultaneously detecting DNA methylation and single nucleotide variation of bladder cancer driver genes, as well as related kits, systems and applications. Background technique [0002] Bladder cancer is the most common malignant tumor of the urinary system, ranking sixth in the incidence of male tumors in my country. Among them, the incidence rate of men is 3-4 times that of women, and the mortality rate of women is higher than that of men. Due to the need for continuous review and follow-up after surgery and the high recurrence rate (the recurrence rate of non-muscle invasive bladder can reach 60-70%), bladder cancer has become the most expensive type of adult cancer for diagnosis and treatment. [0003] Poor prognosis and easy recurrence are important features of bladder cancer, and effective treatment largely depends on early diagnos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/154C12Q2600/156Y02A50/30C12Q1/6827C12Q2537/143C12Q2563/107
Inventor 陆利徐根明赵谦
Owner HUNAN YEARTH BIOTECHNOLOGICAL CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More