A kind of microporosa haemorrhoids strain and its artificial cultivation method and application
A technology for the artificial cultivation of Microporosa haemorrhoids, which is applied in the field of Microporosa haematoporia strains and its artificial cultivation, and can solve problems such as the lack of large-scale cultivation and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Identification of Pycnoporus sanguineus(L.) Murrill
[0057] Liu Yuanchao and Huang Zhiyong collected a specimen of Microporia haemorrhoids (preliminary identification) in Wuyishan, Fujian, as shown in figure 1 shown. The PDA pure culture was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit to obtain The DNA solution was refrigerated at -20°C for later use.
[0058] The ITS-PCR experiment of the material was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the fungal ribosomal intergenic region, and the amplification was carried out on a Biometra PCR instrument , the composition of the PCR reaction solution (50 μl in total) is:
[0059] TaKaRaTaq (5units / μl) 0.25μl
...
Embodiment 2
[0070] One, culture medium (by weight percentage):
[0071] 1. Tissue separation medium (comprehensive PDA):
[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.
[0073] 2. Purified mother seed medium (Red Bengal medium):
[0074] Peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO4·7H2O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, and the rest is water.
[0075] 3. Production medium of mother species (enriched with comprehensive PDA):
[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.
[0077] 4. Production medium:
[0078] 98-99% sorghum, 1-2% calcium carbonate.
[0079] 5. Cultivation material:
[0080] 39% miscellaneous sawdust, 20% cottonseed hulls, 20% corncobs, 17% wheat bran, 3% corn flour, 1% lime, materia...
Embodiment 3
[0104] Example 3 Inhibition of tumor cell function
[0105] 1. Experimental method
[0106] 1. Preparation of ethyl acetate extract
[0107] Thrombus strains were fermented in solid state, and the culture medium was rice and water. After cultivating for 45 days, the rice culture medium covered with mycelia was soaked in ethyl acetate for 10 hours, then ultrasonically extracted, ultrasonically extracted for 100 min, extracted twice, and the second organic phase was combined. After the collected organic phase was suction-filtered, the liquid obtained by the suction filtration was rotary-evaporated with a rotary evaporator until there was no liquid drop, and stored at low temperature (4° C.) for future use. Simultaneous fermentation of other wild strains was performed in the same manner as a control. Paclitaxel was used as a positive control with a concentration of 0.5 mg / ml.
[0108] 2. Tumor cell culture
[0109] Tumor cell HepG2 (human liver cancer) was cultured with DMEM...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap