PCR primers, PCR methods and kits for detecting Staphylococcus cocci
The technology of a staphylococcus and a kit is applied in the field of detection of pathogenic microorganisms, and can solve the problems of unfavorable early identification, rapid detection or control of the infection of the bacteria, no specific PCR method for Staphylococcus korea, and difficulty in distinguishing bacteria, etc. Achieve the effect of simple and easy operation of result analysis, shortening detection time, and not easy to misjudgment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Example 1 Common bacterial standard strains and DNA samples
[0065] Standard strains: 1 strain of Staphylococcus korekii subsp. urealyticum (ATCC 49330), 14 strains of Staphylococcus koreai isolates, 3 strains of Staphylococcus xylose, 3 strains each of Staphylococcus epidermidis and Staphylococcus squirrels, 2 strains of Staphylococcus lentus, 2 strains of Staphylococcus equisetum, 1 strain of Staphylococcus wornerii, 1 strain of Staphylococcus capitis, 1 strain of Staphylococcus hemolyticus, 1 strain of Staphylococcus cruzi, a total of 32 strains, and 7 other strains such as: Vitis aureus Coccus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Clostridium sporogenes, Bacillus cereus, Corynebacterium murine, etc. All strains are stored at -70 ℃ in our laboratory.
[0066] Bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP302) was used to extract bacterial genome nucleic acid for specific experiments of PCR method.
Embodiment 2
[0067] Example 2 DNA extraction from clinical samples
[0068] 20 mouse fecal samples (about 50 mg each) were collected in a sterile environment, and nucleic acid was extracted with a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP302). The operation was carried out in strict accordance with the kit instructions, and the DNA was washed with 60 μL After taking off, store at -20°C until use.
Embodiment 3
[0069] Example 3 Primer Design and Synthesis
[0070] Primers were designed using Primer Premier 5 primer design software according to the HSP60 gene sequence of S.
[0071] Upstream primer SEQ ID NO.1:
[0072] 5’-GTAGAAGGTATGCAATTCGAC-3’
[0073] Downstream primer SEQ ID NO.2:
[0074] 5’-GGATATGGTCTTTCTAACTCT-3’
[0075] The size of the amplified fragment was 92 bp. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., as shown in SEQ ID NO.3.
[0076] SEQ ID NO. 3:
[0077] GTAGAAGGTATGCAATTCGACAGAGGTTATCAATCTCCATATATGGTCACAGATTCAGATAAAATGGTTGCAGAGTTAGAAAGACCATATCC
PUM
Property | Measurement | Unit |
---|---|---|
melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com