Supercharge Your Innovation With Domain-Expert AI Agents!

Hepatitis c virus detection kit

A technology of hepatitis C virus and detection kit, which is applied in the field of virus detection and can solve the problems of long reaction time and increased cost

Active Publication Date: 2019-09-20
GUANGDONG FAPON BIOTECH CO LTD
View PDF14 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] From the current market, the detection of antigen-antibody joint inspection items is limited to ELISA, plate luminescence, and time resolution. These methodologies have long reaction times, and consume less manpower and material resources, and increase costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis c virus detection kit
  • Hepatitis c virus detection kit
  • Hepatitis c virus detection kit

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0058] (1) Preparation of HCV-AgI coated antigen: adopt genetic engineering technology means, analyze and screen out HCV NS3 by a large amount of molecular biology analysis software, NS4, the dominant epitope section of core antigen, sequence is SEQIDNo.1 (named was W135), optimized the codon sequence to synthesize the gene, and designed primers (W135-F: CGCGGATCCATGTCTACCAACCCGAAACCG; W135-R: CCGGAATTCACGAGAAGCGAAAGCGATCA) to amplify the DNA segment corresponding to W135. Has an EcoRI restriction site. After the PCR fragment was recovered by the kit (purchased from Shanghai Huashun Biological Engineering Co., Ltd.), it was digested with BamHI and EcoRI (various molecular biology enzymes used in the present invention were all purchased from Dalian Bao Biological Engineering Co., Ltd.), It was ligated into the expression vector pET-24a (Novagen, Cat. No.: 69864-3) digested with BamHI and EcoRI to obtain the recombinant plasmid pET-24a-W135.

[0059] The above-mentioned positiv...

Embodiment 3

[0113] Example 3 Preparation of Magnetic Bead Labeled Antigen and Antibody

[0114] 1) Take 10mg of carboxyl magnetic beads (Merk EM1-100 / 40 carboxyl magnetic beads) and wash with activation buffer (100mM MES pH5.5) 4 times, 10 mL each time, and finally add 8 mL of activation buffer, and disperse by ultrasonication. Weigh about NHS (10mg) and EDC (5mg), (NHS (N-hydroxysuccinimide purchased from Thermo, model: 24510) and EDC purchased from Thermo, model: 22891) were dissolved to 10mg / mL and 1mg / mL, respectively, Add 1mL NHS solution and 1mL EDC solution, mix thoroughly, and rotate (30rpm) at room temperature for 10 minutes.

[0115] 2) Magnetic separation, discard the supernatant, do not wash, directly add 9mL cross-linking buffer (same as activation buffer: 100mM MES pH5.5), ultrasonically disperse; divide the activated magnetic beads into two parts, take a part of 4.5ml Add 0.5mL of HCV-AgI (4.0mg / mL) to the activated magnetic beads, add 0.5ml of HCV-AgI to another 4.5ml of ...

Embodiment 4

[0118] Example 4 Coupling preparation of avidin (SA) and acridinium ester (AE)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a hepatitis c virus detection kit. The hepatitis c virus detection kit comprises a first antibody and a second antibody for detecting a hepatitis c virus core antigen. The first antibody combines 95th-117th amino acid sequence of the hepatitis c virus core antigen aiming at an epitope or specificity in the 95th-117th amino acid sequence of the hepatitis c virus core antigen. The second antibody combines 55th-72th amino acid sequence of the hepatitis c virus core antigen aiming at the epitope or the specificity in the 55th-72th amino acid sequence of the hepatitis c virus core antigen. The kit has high sensitivity, good stability and simple operation, and can be used for rapid detection of early acute hepatitis c.

Description

technical field [0001] The invention relates to the field of virus detection. Specifically, the present invention relates to a detection method and kit for hepatitis C virus. Background technique [0002] Hepatitis C is one of the infectious diseases that seriously threaten human health, and there is currently no effective vaccine to prevent its spread. The emergence of direct-acting antiviral drugs (DAAs) has greatly improved the treatment effect of hepatitis C, but DAAs drugs are not yet listed in China. At present, the main regimen of antiviral therapy for HCV-infected patients in my country is still based on interferon therapy. Compared with hepatitis B in terms of clinical manifestations, hepatitis C has milder symptoms, slower development, and rare severe symptoms, which is not easy to attract the attention of clinicians and patients. HCV is mainly transmitted through blood transfusion and transfusion of blood products. Hepatitis C virus can cause acute or chronic i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68
CPCG01N33/6854G01N33/5767G01N2469/10
Inventor 潘少丽李瑞净于秀玲程珍珠武云波陈一尘池朗山龚航欧阳岁燕
Owner GUANGDONG FAPON BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More