Hepatitis c virus detection kit
A technology of hepatitis C virus and detection kit, which is applied in the field of virus detection and can solve the problems of long reaction time and increased cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0058] (1) Preparation of HCV-AgI coated antigen: adopt genetic engineering technology means, analyze and screen out HCV NS3 by a large amount of molecular biology analysis software, NS4, the dominant epitope section of core antigen, sequence is SEQIDNo.1 (named was W135), optimized the codon sequence to synthesize the gene, and designed primers (W135-F: CGCGGATCCATGTCTACCAACCCGAAACCG; W135-R: CCGGAATTCACGAGAAGCGAAAGCGATCA) to amplify the DNA segment corresponding to W135. Has an EcoRI restriction site. After the PCR fragment was recovered by the kit (purchased from Shanghai Huashun Biological Engineering Co., Ltd.), it was digested with BamHI and EcoRI (various molecular biology enzymes used in the present invention were all purchased from Dalian Bao Biological Engineering Co., Ltd.), It was ligated into the expression vector pET-24a (Novagen, Cat. No.: 69864-3) digested with BamHI and EcoRI to obtain the recombinant plasmid pET-24a-W135.
[0059] The above-mentioned positiv...
Embodiment 3
[0113] Example 3 Preparation of Magnetic Bead Labeled Antigen and Antibody
[0114] 1) Take 10mg of carboxyl magnetic beads (Merk EM1-100 / 40 carboxyl magnetic beads) and wash with activation buffer (100mM MES pH5.5) 4 times, 10 mL each time, and finally add 8 mL of activation buffer, and disperse by ultrasonication. Weigh about NHS (10mg) and EDC (5mg), (NHS (N-hydroxysuccinimide purchased from Thermo, model: 24510) and EDC purchased from Thermo, model: 22891) were dissolved to 10mg / mL and 1mg / mL, respectively, Add 1mL NHS solution and 1mL EDC solution, mix thoroughly, and rotate (30rpm) at room temperature for 10 minutes.
[0115] 2) Magnetic separation, discard the supernatant, do not wash, directly add 9mL cross-linking buffer (same as activation buffer: 100mM MES pH5.5), ultrasonically disperse; divide the activated magnetic beads into two parts, take a part of 4.5ml Add 0.5mL of HCV-AgI (4.0mg / mL) to the activated magnetic beads, add 0.5ml of HCV-AgI to another 4.5ml of ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap