Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Double primer and its application

A dual-primer and product technology, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of high cost of full-length sequencing

Inactive Publication Date: 2019-09-03
汪雪 +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, (1) The sequencing of plasmid / DNA vectors (circular DNA molecules) occupies a large share of the sequencing market. Common sequencing technologies can only read the position of 300-500 bp behind the sequencing primers, and the cost of full-length sequencing It is also very expensive, and the high-fidelity, rapid amplification capability and RCA reaction characteristics of Phi29 enzyme are suitable for the rapid identification of traditional plasmid / DNA carrier molecules; (2) circular RNA is a new type of RNA molecule discovered in recent years. The structure is not decomposed by RNase and is regarded as a stable biomarker with great potential. At the same time, the research on the mechanism related to circular RNA is also a hot spot in recent years. Establish a method for quickly identifying circular RNA and even measuring circular RNA, whether in Both clinical application and scientific research have great market application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double primer and its application
  • Double primer and its application
  • Double primer and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Identification of embodiment 1 circular DNA / RNA

[0077] according to figure 2 Based on the principle of using circular DNA / RNA with a size of 1467bp as a template to design double primers, the double primers are dispersed primers, and the distance between the 3' ends of the first primer and the second primer in the double primers is 200bp, and the specific sequence as follows:

[0078] First primer (SEQ ID NO.1): GGCTTCAAGTGGGAGAGATTCA

[0079] Second primer (SEQ ID NO.2): GGATGTCGGCAGGGTGTTTA

[0080] The designed double primers are used for the identification of circular DNA / RNA, the specific steps are as follows:

[0081] 1) Primer and template annealing complementary reaction

[0082] The primers anneal to the template strand and complement each other, and the specific reaction system is shown in Table 1 below:

[0083] Table 1

[0084]

[0085]

[0086] Carry out PCR reaction, specific conditions: 95°C for 3min, 4°C for more than 2min;

[0087] 2) Ro...

Embodiment 2

[0106] Compared with Example 1, the only difference is that the amount of restriction endonuclease is 0.5U, and other reagents and methods are the same as in Example 1.

Embodiment 3

[0108] Compared with Example 1, the only difference is that the amount of restriction endonuclease is 1 U, and other reagents and methods are the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, relates to a double primer and an application thereof, and particularly relates to a double primer for rolling circle amplification / identification of circular nucleic acid, a reaction system, a kit thereof, and the use thereof, wherein the double primer is a dispersion-type primer, and a distance between the 3' ends of a first primer and a second primer of the double primer is 0 to 1000 bp, the double primer is capable of performing molecular identification of circular DNA / RNA, and the identification method is accurate, rapid, convenientand intuitive, and provides an effective means for discovering the novel circular DNA / RNA.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a double primer and its application, in particular to a double primer for rolling circle amplification / identification of circular nucleic acid, a reaction system composed of it, a kit composed of it and its application. Background technique [0002] Phi29 DNA polymerase (referred to as Phi29 enzyme) is a nucleic acid polymerase with high continuous synthesis ability and strand displacement, and is a commonly used PCR amplification enzyme. General PCR amplification is often biased, resulting in a large amount of redundancy during amplification, resulting in inaccurate amplification and affecting the detection results of the amplified product in sequencing. The direction of Phi29 enzyme amplification is 5'→3', with 3'→5' exonuclease correction activity, which can cut off the non-specific amplification products along the 3'→5' reverse direction to reduce non-specific amplification. There...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/6844
CPCC12Q1/6844C12Q2525/307C12Q2531/125C12Q2521/301
Inventor 汪雪金柳王孟强
Owner 汪雪
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More