Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for identifying duck carcass performance in early stage and identification method and application thereof

A technology for molecular markers and identification of ducks, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of slow progress in phenotypic breeding methods and inability to achieve early identification, and achieve accelerated The progress of genetic selection, the reduction of feeding cost, and the effect of improving growth traits

Active Publication Date: 2019-08-16
ANQING YONGQIANG AGRI SCI & TECH
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art, and provide a molecular marker and its identification method for early identification of duck carcass performance, so as to realize early detection by using molecular marker technology, and overcome the slow progress of phenotypic breeding methods, which cannot be realized. Early identification of technical issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying duck carcass performance in early stage and identification method and application thereof
  • Molecular marker for identifying duck carcass performance in early stage and identification method and application thereof
  • Molecular marker for identifying duck carcass performance in early stage and identification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1. Materials

[0027] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.

[0028] 2. Method

[0029] 2.1 Primer design:

[0030] Using the partial nucleotide sequence of the insulin-like growth factor binding protein gene IGF2BP1 shown in SEQ ID NO.1 as a template, design specific amplification primers P2-F, P2-R, the sequence is as follows:

[0031] SEQ ID NO. 3: P2-F: AGGGAAAGTGGAGCTTCATGG

[0032] SEQ ID NO. 4: P2-R: TGCCTTCTTTATCTCACTGGGGA

[0033] The primers can amplify the 1239-1456 positions of SEQ ID NO.1, a total of 218bp sequence, including 1385-1407 23bp insertion / deletion fragments.

[0034] 2.2 Extraction of total blood DNA

[0035] Select 300 local ducks, including 60 male ducks and 240 female ducks, take blood from the wing vein, extract the total DNA of the blood, and use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for identifying duck carcass performance in the early stage and an identification method and application thereof. The molecular marker is a polymorphic sitedeveloped on the basis of insulin-like growth factors and protein gene IGF2BP1 and is capable of affecting the expression quantity of the protein gene IGF2BP1, the molecular marker is an insertion / deletion sequence located at the 1386th-1408th site of the IGF2BP1 gene sequence, the length of the insertion / deletion sequence is 23bp, and the nucleotide sequence of the insertion / deletion sequence isas shown in SEQ ID No. 2; by identifying the types of the molecular marker in a duck genome, the duck carcass performance can be judged through molecular screening in the early stage, and a direct technological means is provided for local small-scale sheldrake breeding; by early-stage breeding, feeding cost can be lowered while growth traits can be genetically fundamentally improved, and accordingly genetic breeding progress can be accelerated.

Description

technical field [0001] The invention relates to the technical field of molecular markers, in particular to a molecular marker for early identification of duck carcass traits based on the insulin-like growth factor binding protein gene IGF2BP1, and an identification method and application thereof. Background technique [0002] my country's fast and large white-feathered meat ducks grow rapidly due to high selection and hybridization. However, with the increase of residents' demand for local characteristic duck species, the market share of local high-quality small shelducks has increased year by year. Local high-quality small shelducks generally have the characteristics of long growth period and low feed conversion efficiency, but good meat quality and good flavor. However, the typical characteristics of local high-quality small shelducks are poor growth and development uniformity, and low production efficiency, which brings more confusion to large-scale breeding. Therefore,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 陈兴勇耿照玉邝金龙杜叶叶
Owner ANQING YONGQIANG AGRI SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More