Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lilium regale wilson LrWRKY2 gene and application

A gene and lily technology, applied in the LrWRKY2 gene and application field of Minjiang lily, can solve the problem that the biological function and transcriptional regulation mechanism are far from being elucidated.

Inactive Publication Date: 2019-05-31
YANGTZE NORMAL UNIVERSITY
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies have shown that Lilium Minjiang has strong resistance to lily fungal and viral diseases, and a number of stress-related genes have been obtained from Lilium Minjiang, such as Lr14-3-3 , LrPR10 , LrbZIP1 and LrWRKY1 etc. (Li H., et al. , Sci. Hort. 2014, 168:9-16; He H., et al. , Genes Genom. 2014, 36:497-507; Zhang N.N., Genes Genom. et al. , 2014, 36:789-798; Han Q., et al. , Sci. Hort.2016, 198:370-378; Patent No. 201610001896.4), but there is no report on the regulation of plant growth and development by the WRKY transcription factor gene of Minjiang lily, and its biological function and transcriptional regulation mechanism are far from elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lilium regale wilson LrWRKY2 gene and application
  • Lilium regale wilson LrWRKY2 gene and application
  • Lilium regale wilson LrWRKY2 gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Cloning Lilium Minjiang LrWRKY2 full-length gene sequence

[0035] Currently, Minjiang Lily ( Lilium regale Wilson's genome sequencing has not yet fully started, and the research group obtained relevant information through the sequencing and analysis of transcripts from different organizations LrWRKY2 reads sequence, through sequence splicing, its full-length sequence was preliminarily obtained; in order to verify the real existence of LrWRKY2 The full-length gene, and then design specific primers (LrWRKY2-ATG-F and LrWRKY2-Stop-F) for PCR amplification analysis.

[0036] The leaf tissue of Minjiang Lily at the budding stage was taken as the material, and the total RNA was extracted by using TRIzol™ Plus RNA Purification Kit (12183555, Invitrogen™) according to the instruction manual, and the residual trace DNA was removed by DNase I (18047019, Invitrogen™), and analyzed by a spectrophotometer Determine the concentration of RNA and set aside.

[0037] Ab...

Embodiment 2

[0045] Example 2 Recombinant expression vector p -TF101- P35S::GFP-LrWRKY2-NOS Construction and subcellular localization analysis

[0046] (1) build p -TF101- P35S::GFP-LrWRKY2-NOS Expression vector

[0047] Minjiang lily LrWRKY2 For the full-length gene sequence (SEQ ID NO.1), design primers LrWRKY2-gfp-F and LrWRKY2-gfp-R, and introduce seamless cloning (In-fusion) vector adapter sequence and restriction site sequence into the primers. Using the TA-connected positive clone plasmid in Example 1 as a template, use LrWRKY2-gfp-F (forward primer) and LrWRKY2-gfp-R (reverse primer) as primers for gene expression LrWRKY2 specific amplification.

[0048] The primer sequences are as follows:

[0049] LrWRKY2-gfp-F:

[0050] 5'- TTCCCCGGGCTCGAGAAGCTT ATGGAGAACAAAATGGGATGG-3';

[0051] LrWRKY2-gfp-R:

[0052] 5'- TTATCTAGATCCGGTGGATCC TCACCACCACCTGAAGTTGG-3';

[0053] Among them, the bold sequence of LrWRKY2-gfp-F is the Hind III restriction site, and the bold sequenc...

Embodiment 3

[0066] Example 3 Recombinant expression vector pBI121 - P35S::LrWRKY2-NOS Construction and genetic transformation of Arabidopsis

[0067] (1) Build pBI121 - P35S::LrWRKY2-NOS overexpression vector

[0068] Minjiang lily LrWRKY2 For the full-length gene sequence (SEQ ID NO.1), design primers LrWRKY2-inf-F and LrWRKY2-inf-R, and introduce seamless cloning (In-fusion) vector adapter sequence and restriction site sequence into the primers. Using the positive cloning plasmid connected by TA in Example 1 as a template, and using LrWRKY2-inf-F and LrWRKY2-inf-R as primers for gene expression LrWRKY2 specific amplification.

[0069] The primer sequences are as follows:

[0070] LrWRKY2-inf-F:

[0071] 5'- GGACTCTAGAGGATCC ATGGAGAACAAAATGGGATGG-3'

[0072] LrWRKY2-inf-R:

[0073] 5'- GATCGGGGAAATTCGAGCTC TCACCACCACCTGAAGTTGG-3'

[0074] Among them, the bolded sequence of the forward primer LrWRKY2-inf-F is the BamHI restriction site, and the bolded sequence of the re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lilium regale wilson LrWRKY2 gene and application. A nucleotide sequence of the LrWRKY2 gene is shown in SEQ ID NO.1, and the coded amino acid sequence of the gene is shown in SEQ ID NO.2. According to the gene, an expression carrier with the LrWRKY2 gene is transferred into an arabidopsis thaliana plant, the acquired transgenic arabidopsis thaliana plant shows creep growth, and the original growth form of wild arabidopsis thaliana is thoroughly changed; multiple lotus-throne-shaped basal leaves grow up on the arabidopsis thaliana stems with creep growth, the edges ofthe leaves have a special regular-protruding form, the arabidopsis thaliana is extremely suitable for large-scale cultivation and application in a courtyard and landscaping, and meanwhile the gene provides the theoretical basis and technical support for preparation of a novel ground cover plant and has potential application prospects.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to a Minjiang lily LrWRKY2 Genes and applications. Background technique [0002] Plant type is one of the important characters of ornamental plants, and breeding ideal plant type is an important goal of ornamental plant breeding. Prostrate growing plants are more suitable for the construction of ground cover landscape because of their low plant, small branch angle and close to the ground, and have broad application prospects in gardens. Research on creeping transgenic plants helps to expand its application value and further promote its application in landscaping and landscaping. [0003] WRKY is a family of transcription factors that are ubiquitous and conserved in plants. first identified plant WRKY Gene is sweet potato ( Impoea batatas ) SPF1 (SPF1:SWEET POTATO FACTOR1) gene, the gene product of which is specifically related to sweet potato Sporamin Ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/20
Inventor 符勇耀杨利平朱艺勇徐文姬
Owner YANGTZE NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com