Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of novel ScCas12a protein in nucleic acid detection

A nucleic acid technology, applied in the application field of new ScCas12a in nucleic acid detection, can solve the problem of inactivity of homologous proteins

Pending Publication Date: 2019-04-23
GUANGZHOU PLUSLIFE TECH CO LTD
View PDF3 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, according to the research results of Zhang Feng's team, there are large differences among the Cpf1 / Cas12a protein family, and some of the same family proteins are inactive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of novel ScCas12a protein in nucleic acid detection
  • Application of novel ScCas12a protein in nucleic acid detection
  • Application of novel ScCas12a protein in nucleic acid detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Discovery of Cpf1 / ScCas12a gene

[0065] We found a Cas12a protein with DNA cutting activity from Smithella sp.SC_K08D17, denoted as ScCas12a (sequence shown in SEQ ID NO.1). The double-stranded DNA substrate, ScCas12a protein and gRNA were added to the reaction system in vitro, and it was found that the double-stranded DNA substrate could be specifically cleaved by the ScCas12a protein mediated by gRNA.

[0066] At the same time, the inventor's team found that when selecting the gRNA targeting sequence, the 5' end of the targeting sequence should have a 5'-TTTN-3' sequence, and the targeting sequence itself does not form a stable secondary structure, targeting sequence and The rest of the sequences do not form a stable secondary structure. Under this sgRNA design principle, ScCas12a has the activity of targeting DNA sequences in vitro or genome sequences in vivo for specific cleavage.

[0067] The following example gives the preparation of ScCas12a protein a...

Embodiment 2

[0068] Cloning and protein expression of embodiment 2 Cpf1 / ScCas12a gene

[0069] 1. PCR amplification of Cas12a sequence

[0070] (1) Design primers

[0071] The upstream and downstream primers were designed according to the ScCas12a sequence, and the sequence is as follows:

[0072] Upstream primer (shown in SEQ ID NO.4):

[0073] GTGCGGCCGCCATGCAGACCCTGTTTGAGAACTTCACA;

[0074] Downstream primer (shown in SEQ ID NO.5):

[0075] GTGGCGCGCCTGGCATAGTCGGGGACATCATATG.

[0076] (2) PCR amplification

[0077] Utilize the above-mentioned upstream and downstream primers, and use high-fidelity DNA polymerase (phusion DNA polymerase) to perform PCR amplification on the target fragment at different annealing temperatures. The results are attached figure 1 Shown, PCR target band (about 4000bp).

[0078] 2. Construction of recombinant plasmid pET-28a-ScCas12a

[0079] (1) PCR amplification product purification: the product after PCR amplification is purified by Qiagen's purifica...

Embodiment 3

[0093] Example 3 Purification of ScCas12a protein

[0094] 1. Purification method of ScCas12a protein

[0095] The bacteria solution after induction of expression was centrifuged, the bacteria were resuspended in the lysis buffer, ultrasonicated (70% amplitude, 2s On / 4s Off, 3 minutes, Sonics 750w ultrasonic instrument), and the supernatant was separated by centrifugation. Load protein lysate supernatant to equilibrated Ni Sepharose FF, wash away impurity proteins with lysis buffer greater than 30 times column bed volume, and elute with elution buffer, use Superdex 200, Tricorn 10 / 300 gel column for purification. After elution, SDS-PAGE analysis and observation results and gel column purification were carried out to obtain the purified Cas12a protein. Wherein, the lysis buffer contains 50 mM Tris-HCl, pH 8.0 300 mM NaCl, 5% glycerol, and 20 mM imidazole. Elution buffer contained 50 mM Tris-HCl, pH 8.0 300 mM NaCl, 5% glycerol, 250 mM imidazole.

[0096] The resulting prote...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of novel ScCas12a protein in nucleic acid detection. It is found through research that the novel ScCas12a protein with DNA cleavage activity can be used for nucleicacid detection, gene editing and gene modification as a novel CRISPR / ScCas12a system and provide new necessary tool selection for Cas12a-based gene editing, modification and molecular detection. Theinvention also provides a novel nucleic acid detection system comprising the ScCas12a protein and gRNA and a kit. The molecular detection with high sensitivity and high precision can be achieved at room temperature of 25-37 DEG C, the detection specificity is good, the sensitivity is high, the cost is low, the operation is convenient and fast, the application range is wide, and the application prospect in nucleic acid detection is good.

Description

technical field [0001] The invention belongs to the technical field of molecular biology. More specifically, it relates to the application of a novel ScCas12a in nucleic acid detection. Background technique [0002] In order to achieve highly sensitive and high-precision detection of pathogens, etc., it is very important to develop low-cost, accurate, efficient, and rapid diagnostic methods. In terms of pathogen detection, the use of classic culture-based phenotypic assays to determine susceptibility or resistance, ELISA, etc. are general methods used in clinical pathogen detection. However, because pathogens cannot be completely cultured in vitro, and the detection sensitivity of related proteins and small molecules is limited, traditional detection methods are time-consuming and not accurate. Molecular-based diagnostic methods can improve the speed and accuracy of detection, which is of great significance for infection control, prevention, and treatment in hospital and c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12Q1/68
Inventor 刘华勇陈翀胡洋
Owner GUANGZHOU PLUSLIFE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com