Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Corn dominant nuclear genic sterility line prepared from p5126-ZmMs1M construct and seed breeding and producing application method thereof

A technology of nuclear sterile lines and constructs, applied in the fields of application, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as unstable purity, difficulty in application, and susceptibility to environmental influences

Active Publication Date: 2019-03-22
BEIJING SHOU JIA LI HUA SCI TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods have many disadvantages, such as high cost, unstable purity, and susceptibility to environmental influences, which restrict the application efficiency of heterosis in the actual production of corn.
[0005] Maize dominant male sterile materials do not have the problem of detasseling, but due to the lack of effective maintenance and reproduction techniques, it is difficult to apply them in actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn dominant nuclear genic sterility line prepared from p5126-ZmMs1M construct and seed breeding and producing application method thereof
  • Corn dominant nuclear genic sterility line prepared from p5126-ZmMs1M construct and seed breeding and producing application method thereof
  • Corn dominant nuclear genic sterility line prepared from p5126-ZmMs1M construct and seed breeding and producing application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction of dominant sterility vector p5126-ZmMs1M

[0031] 1. Construction of pT5126-ZmMs1Ocs vector (contains p5126-ZmMs1 dominant sterility element, expression cassette SEQ ID NO.1)

[0032] Genomic DNA was extracted from the maize inbred line B73 with the PlantGen DNA Kit Plant Genomic DNA Extraction Kit (Kang Wei Century Company). Using the obtained genomic DNA as a template to amplify the 5126 promoter fragment, the primers used are as follows:

[0033] Oligo05: 5'-gaattcctaggatctttctgat ttcaaccat (GAATTC is the EcoRI restriction site);

[0034] Oligo06: 5'- gccgcggccgccgccggtcatggatccgggccccgcaaagcaactttgatttg (GCGGCCGC is the NotI restriction site).

[0035] The 1.5 kb fragment of the amplified product, namely the 5126 promoter, was ligated into the pEASY-T5 vector, and the obtained vector was named pT5126.

[0036] RNA was extracted from maize inbred line B73 and amplified by reverse transcription PCR ZmMs1 gene, get 650 bp ZmMs1 Gene fragme...

Embodiment 2

[0061] Example 2: Application of dominant sterility vector p5126-ZmMs1M

[0062] 1. Obtaining dominant sterility transgenic lines through Agrobacterium-mediated genetic transformation of maize

[0063] Referring to the AN (Methods in Enzymology (1987) 153:292-305) method, the dominant nuclear sterile vector p5126-ZmMs1M constructed by the present invention was transformed into Agrobacterium EHA105 (Hood et al., Transgenic Res (1993) 2: 208-218), after identification, the positive strains obtained by transformation were selected for Agrobacterium-mediated maize genetic transformation, and the strains used were preserved in the General Microbiology Center (CGMCC) of the China Committee for the Collection of Microbial Cultures. The classification is named "Escherichia coli (Eschrichia coli)", and the inventor named it "p5126Ms1M"; preservation address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing; preservation date: September 14, 2018 ; Deposit number: CGMCCNO.164...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a technological system for preparing a corn dominant genic male sterility line from a p5126-ZmMs1 and mCherry gene construct and a corn seed cross breeding and producing application method thereof. The construct contains three gene expression cassettes: an expression cassette for causing corn dominant genic male sterility, an expression cassette for marking corn peel colorand a weed killer resistance expression cassette. When the construct is guided into a corn callus tissue, the corn dominant genic male sterility line seeds can be prepared; under normal light, the transgenic sterility line seeds have no obvious difference from the non-transgenic fertile seeds, and goods quality is not affected; however, under green excitation light, the transgenic sterility line seeds show red fluorescence, and the non-transgenic fertile seeds show normal corn color and have no fluorescence. The technological system disclosed by the invention has qualitative difference from acorn recessive male sterility technology (namely a corn multi-control sterility technology system) which has been already applied for authorization by the team and can be efficiently applied to corn sterility cross breeding and hybrid seed production.

Description

technical field [0001] Generally, the present invention relates to the fields of molecular biology and plant genetic engineering and crop breeding. Specifically, the present invention relates to a method for creating a dominant nuclear male sterile line in maize and comprising a maize pollen-specific promoter p5126 , key genes of male flower development ZmMs1 and seed coat-specific fluorescent genes mCherry The construct, the recombinant vector comprising the construct, and the host cell transformed by the construct or the recombinant vector, the preparation method of the transgenic corn plant cell and the transgenic corn plant, and the corn male sterile line seeds produced therefrom And its hybrid breeding and seed production application method. Background technique [0002] Heterosis is the phenomenon in which a hybrid is superior to its two parents in one or more traits. For example, the first generation of hybrids obtained by crossing different strains, different va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/65C12N5/10A01H1/02A01H5/00A01H5/10A01H6/46
CPCA01H1/02C12N15/65C12N15/8231C12N15/8289
Inventor 万向元吴锁伟张丹凤谢科董振营张煜文鲍建喜安学丽刘欣洁李金萍
Owner BEIJING SHOU JIA LI HUA SCI TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products