American ginseng identification DNA (deoxyribonucleic acid) hybridization method
A hybridization method and a technology for American ginseng are applied in the field of DNA hybridization for identifying American ginseng, which can solve problems such as time-consuming and cost-intensive, and achieve the effects of fast reaction speed, superior detection performance and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] 1. Various solution configurations
[0057]Configuration of the probe solution
[0058] Take the solution and the probe, configure the probe solution, and the components of the configured probe solution are as follows:
[0059] (1) 25 μM amine-labeled oligonucleotide single-stranded
[0060] (2) 1.5M NaCl
[0061] (3) 0.15M sodium bicarbonate
[0062] (4) 0.15% sodium dodecyl sulfate (SDS)
[0063] Configuration of the sample DNA solution to be tested
[0064] Take the solution and the DNA of the sample to be tested, and configure the DNA solution of the sample to be tested, wherein the components of the DNA solution of the sample to be tested are as follows:
[0065] (1) 25nM biotin-labeled oligonucleotide single strand
[0066] (2) 0.15M NaCl
[0067] (3) 0.015M sodium citrate (pH 7.0)
[0068] (4) 0.15% sodium dodecyl sulfate (SDS)
[0069] Configuration of Gold Nanoparticle (AuNP) Solution
[0070] Before the experiment, add the AuNP storage solution to AD...
Embodiment 2
[0081] The screening of embodiment 2 probe sequence
[0082] Two types of probes were designed, respectively denoted as N1Q and N2Q, and the sequences of the two probes were:
[0083] N1Q: CTAAAAAAAAAGTATTTCTCATCTAAATTTTGAA (SEQ ID NO: 1)
[0084] N2Q: GAATTTGAAAGTGTTTTAAAATTGATTTTCAA (SEQ ID NO: 2)
[0085] Two samples of DNA to be tested were prepared, which were respectively derived from Chinese ginseng and American ginseng. The DNA sample to be tested in Chinese ginseng was recorded as Pgin, and the DNA sample to be tested in American ginseng was recorded as Pquin.
[0086] Experiment according to the operation of Example 1, wherein step (4) in Example 1 washes the microfluidic chip with 1 times of PBS buffer for the washing solution, and the experimental results are as follows image 3 shown.
[0087] From image 3 It can be seen from the above that in the reaction area where the probe N2Q is fixed, there is no significant difference in the fluorescence responses of C...
Embodiment 3
[0088] The screening of embodiment 3 gold nanoparticles solution
[0089] Experiment A
[0090] Two copies of the DNA of the sample to be tested were prepared, which were respectively derived from Chinese ginseng and American ginseng.
[0091] Carry out the experiment according to the operation of embodiment 1, wherein step (4) in the embodiment 1 washs the washing solution in the microfluidic chip: (1) group 1 uses 1 times of PBS buffer solution; (2) group 2 uses gold A solution with a concentration of nanoparticles of 5 nM; (3) a solution with a concentration of gold nanoparticles used in group 3 of 10 nM; (4) a solution with a concentration of gold nanoparticles used in group 4 of 15 nM; (5) a solution with a concentration of gold nanoparticles used in group 5 A solution with a gold nanoparticle concentration of 20nM; the experimental results are as follows Figure 4 shown.
[0092] Among them, 1, 3, 5, 7 and 9 in the vertical direction are ginseng reaction areas, and 2,...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap