Hedgehog signal pathway gene associated with amputated limb regeneration of Periplaneta americana and application of dsRNA thereof
A cockroach and gene technology, applied in the field of genes, can solve the problem of undiscovered mutual cannibalism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0130] Example 1 Database Search for Hedgehog Signaling Pathway Genes Related to Severe Limb Regeneration
[0131] Based on the Periplaneta americana genome database, the Hh, Ptc, Smo and Ci genes in the Hedgehog signaling pathway of the American cockroach were searched using bioinformatics methods, and after sequence analysis and comparison, the Hh in the Hedgehog signaling pathway of the American cockroach was obtained , Ptc, Smo and Ci gene sequences are respectively SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4.
[0132] The nucleotide sequence of the Hh gene is shown in SEQ ID No.1:
[0133]ATGAGGGCGGGGGCGCTGATGTGGGGGGCGCTGCTGCTGCTGGCGGCGTCGGCGTCGGGCTGCGGGCCCGGACGAGGGGGAGGGCGCCGTCCCGTGCCCCGCAAGTTGACCCCCCTCGTGTTCAAACAGCACGTGCCCAACGTAAGCGAAAACACCCTTCCAGCAAGCGGTCTCACCGAGGGGCGCGTGACCCGCAAAGACCCTCGCTTCAGGGATCTGGTGCCCAACTACAACGCAGACATCGTGTTCAAGGACGAGGAAGGCACGGGCGCCGACCGCCTCATGACGCAGAGGTGCAAGGAGAAGCTGAACACGCTGGCCATCTCGGTGATGAACCAGTGGCCCGGCGTGAAGCTGCGGGTGACGGAGGGCTGGGACGA...
Embodiment 2d
[0153] The synthesis of embodiment 2dsRNA
[0154] The preparation method of the dsRNA targeting the silenced Hh gene: using pTOPO-Hh as a template, carrying out PCR amplification with primers SEQ ID NO.5 and SEQ ID NO.6 containing T7 promoters at both ends, and then passing the PCR amplification product through T7 RiboMAX TMExpress RNAi System transcription kit (Promega) synthesized dsRNA, the sequence is shown in SEQ ID NO.17;
[0155] Preparation method of dsRNA targeting silencing Ptc gene: using pTOPO-Ptc as a template, using primers SEQ ID NO.7 and SEQ ID NO.8 containing T7 promoters at both ends for PCR amplification, and then using the PCR product as a template T7 RiboMAX TM Express RNAi System transcription kit (Promega) carries out the synthesis of dsRNA, and the nucleotide sequence of dsRNA is SEQID NO.18;
[0156] Preparation method of dsRNA targeting silencing Smo gene: use pTOPO-Smo as a template, use primers SEQ ID NO.9 and SEQ ID NO.10 containing T7 promoter...
Embodiment 3
[0174] Embodiment 3dsRNA in vivo injection affects the regeneration of severed limbs of Periplaneta americana
[0175] In order to verify the function of the screened Hh, Ptc, Smo and Ci genes in the Hedgehog signaling pathway in the process of limb regeneration in Periplaneta americana, dsRNA injection was performed on newly amputated Periplaneta americana. CK that does not target any gene of Periplaneta americana was used as a negative control for dsRNA injection treatment.
[0176] The steps are as follows: first select the larvae of Periplaneta americana (d0) that have just molted, continue to cultivate for one day to make them adapt to the surrounding environment, then inject dsRNA for the first time (d1) to them, and perform injection on one side of the hind limb of Periplaneta americana 24 hours later. Amputation operation (d2) is to keep the complete base and trochanter, and cut off the femur, tibia and tarsus together (see figure 1 A), and then two other dsRNA interf...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com