Method for detecting single cell mitochondrial copy number
A detection method and mitochondrial technology, which are applied in the fields of biochemical equipment and methods, and the determination/inspection of microorganisms, can solve the problems of uncertain definition of the measurement unit of chrM, undetectable ratio, inconsistent results, etc., and achieve short detection cycle, operation Simple, specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0036] The single-cell mitochondrial copy number detection method of the present invention comprises the following steps:
[0037] (1) Design of probes and primers: Design corresponding primers for the mitochondrial DNA 11778 site. First, design a pair of primers with a product of about 1000 bp in the upstream and downstream sequences of the mitochondrial DNA 11778 site as primers for standard preparation (sequence 1 and Sequence 2); A pair of Taqman probes were designed for the G>A mutation at the mitochondrial DNA 11778 site, including the VIC probe without the mutation (Sequence 3), the FAM probe with the mutation (Sequence 4) and the primers required for the probe (Sequence 5 and Sequence 6),
[0038] The primer sequences are as follows:
[0039] Sequence 1: CAACAAACCTATTTAGCTGTTCCCC;
[0040] Sequence 2: GTAAGGCGAGGTTAGCGAGG;
[0041] Sequence 3: CACAGTCGCATCATA (Taqman probe whose fluorophore is VIC and quenching group is MGB);
[0042] Sequence 4: ACTCACAGTCACATCA (...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap