Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

WRKY20 protein and application of encoding gene thereof in regulating stress resistance of plants

A WRKY20, plant stress resistance technology, applied in the field of genetic engineering, can solve problems such as difficulty in feeding insects

Active Publication Date: 2019-01-04
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF9 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The piercing-sucking insect Bemisia tabaci will activate hormone resistance pathways such as Jasmonic acid (JA), ethylene (Ethylene, ET) and salicylic acid (Salicylic acid, SA) in plants, and the corresponding defense genes will Changes that make it harder for insects to feed further

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • WRKY20 protein and application of encoding gene thereof in regulating stress resistance of plants
  • WRKY20 protein and application of encoding gene thereof in regulating stress resistance of plants
  • WRKY20 protein and application of encoding gene thereof in regulating stress resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0136] Embodiment 1, the cloning of AtWRKY20 gene and the construction of AtWRKY20 gene expression vector

[0137] This embodiment provides the AtWRKY20 gene and its encoded protein derived from Arabidopsis thaliana. The nucleotide sequence of the genomic DNA of the AtWRKY20 gene in Arabidopsis is sequence 1, and the nucleotide sequence of the DNA in the coding region of the AtWRKY20 gene is sequence 2 The nucleotide sequence of DNA in the promoter region of AtWRKY20 gene is sequence 3, and the amino acid sequence of coding AtWRKY20 protein is sequence 4.

[0138] 1. Cloning of AtWRKY20 gene

[0139] 1. Using Arabidopsis thaliana genomic DNA and leaf cDNA as templates, PCR amplification was performed with upstream primer AtWRKY20-F and downstream primer AtWRKY20-R, and PCR amplification products of about 3393bp and 1674bp were obtained, respectively. The primers used are as follows:

[0140] Upstream primer AtWRKY20-F: 5'-CAAGGGTACCATGAACCCTCAAGCTAATGACCG-3' (SEQ ID NO: 5); ...

Embodiment 2

[0153] Example 2, Application of Knockout Arabidopsis WRKY20 Gene in Plant Insect Resistance

[0154] 1. Detection of plants knocked out of AtWRKY20 gene

[0155] 1. PCR detection of AtWRKY20 gene expression level in Arabidopsis wrky20 mutant

[0156] After treatment with 100 μM methyl jasmonate, wild-type Arabidopsis Col-0, Arabidopsis mutants wrky20-1(SALK_055904) and wrky20-2(SALK_116115) were extracted (the insertion sites of the T-DNA of the two mutants are as follows: figure 1 Shown in A) plant RNA, reverse transcription synthetic cDNA, then utilize the specific primer of AtWRKY20 gene to carry out quantitative PCR analysis, as figure 1 As shown in middle B, the expression level of the AtWRKY20 gene was significantly reduced in the Arabidopsis wrky20 mutant compared with wild-type Arabidopsis. The primers used were: AtWRKY20_qF: GAACCCAAATCCCAGGAGCTAC; AtWRKY20_qR: GGATTTCGTGATTGCTGC. The internal reference is the Arabidopsis ACTIN2 gene, and the internal reference ...

Embodiment 3

[0172] Example 3. Application of Improving Arabidopsis WRKY20 Expression in Regulating Plant Insect Resistance and / or Disease Resistance

[0173] 1. Obtaining AtWRKY20 transgenic Arabidopsis

[0174] The recombinant vector 35S:YFP-AtWRKY20, AtWRKY20 promoter:AtWRKY20 prepared in step 2 of Example 1, and the GUS fusion vector AtWRKY20 promoter:GUS prepared in step 3 of Example 1 were introduced into the Agrobacterium EHA105 strain, and the obtained recombinant Bacteria were transferred into wild-type Arabidopsis Col-0 plants by inflorescence infiltration method to obtain transgenic Arabidopsis seedlings.

[0175] The above-mentioned transformation method is as follows: culture the recombinant bacteria at 220 rpm overnight at 28°C, centrifuge at 4000rpm at 4°C for 20min, collect the bacteria, and wash with infiltration buffer (5% sucrose, 10mM MgCl 2 and 0.02% Silwet L-77) resuspended bacteria liquid is put into 400ml sterilized glass beaker. Select a wild-type Col-0 plant of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a WRKY20 protein and application of an encoding gene thereof in regulating stress resistance of plants. The WRKY20 protein disclosed by the invention is a protein as shown in A1), A2), A3) or A4), wherein A1) is a protein, the amino acid sequence of which is a sequence 4, A2) is a protein, the amino acid sequence of which is a sequence 13, A3) is a protein, the amino acid sequence of which is a sequence 14, and A4) is a protein, the amino acid sequence of which is a sequence 21. Experiments verify that reduction of the WRKY20 protein content plays a role of improving resisting cotton bollworm, two-spotted spider mite and aphids and increase of the WRKY20 protein content plays a role of preventing bemisia tabaci, fungal diseases and geminivirus for plants, thereby providing a gene resource for culturing new species of insect-resistant and / or anti-disease plants. The protein has relatively good potential application value.

Description

technical field [0001] The invention relates to the application of WRKY20 protein and its coding gene in regulating plant stress resistance in the field of genetic engineering. Background technique [0002] In recent years, affected by many factors such as climate change, economic integration and the emergence of new agricultural varieties, the problem of crop diseases and insect pests has become increasingly serious. The characteristics of agricultural diseases and insect pests are many types, large numbers, serious damage, and frequent outbreaks. The crops cause serious harm, resulting in the loss of crop yield and the increase of production costs, and also cause problems in the quality and safety of agricultural products. Common economic crops in my country include the following types of pests and diseases: Bemisia tabaci, rice planthopper, powdery mildew, cotton bollworm, cotton aphid, rice sheath blight, rice blast, two-spotted spider mite, geminivirus disease and rape ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C07K14/415A01H5/00A01H6/82A01H6/60A01H6/20C12N15/29
CPCC12N15/8282C12N15/8286C07K14/415
Inventor 叶建赵平芝
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com