Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of the sex tag pir-mmu-72274 in half-smooth tongue sole

A semi-smooth tongue sole and gender technology, applied in the application field of semi-smooth tongue sole gender tag piR-mmu-72274, to achieve reliable identification results

Inactive Publication Date: 2021-04-16
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In marine animals, there is almost no report on the research on exosome-derived piRNA as a biomarker. The present invention develops a method for the extraction and preliminary application of exosomes derived from fish seminal plasma represented by semi-smooth tongue sole, and solves the problem of semi-smooth tongue sole male fish and Discrimination of the Genetic Sex of Pseudo-Male Fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of the sex tag pir-mmu-72274 in half-smooth tongue sole
  • Application of the sex tag pir-mmu-72274 in half-smooth tongue sole
  • Application of the sex tag pir-mmu-72274 in half-smooth tongue sole

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019]A semi-sliding tongue semen source of exosomes PIR-MMU-72274 as a screening method of biomarkers.

[0020]1. Collection of semen samples

[0021]The semi-slip tongue is collected by 0.5 ml of the centrifugal tube for the isolation and identification of the subjuncus.

[0022]2, extraction of the exosomes

[0023](1) Take 0.5mL semen sample transfer 1.5MLEP tube, placed at 4 ° C, 1200 g from 15 min to remove sperm cells, 4 ° C, 15000 g from 20 min to remove small cell impurities and debris, dilute 1 times with PBS, use 0.45 um filter Pre-filtration was performed, and the filtration was filtered again.

[0024](2) Filtered samples were extracted with the Total Exosome ISOLATION KIT kit.

[0025](3) Collect the dissolution and transfer to a 2 ml tube without RNase.

[0026]3, Identification of Prospectus: Hitachi H600IV transmission electron microscope observation, after transmission electron microscopy analysis, the remaining sample is used for RNA extraction and sequencing analysis.

[0027]4. PiRNA s...

Embodiment 2

[0032]Half-slip tongue semen 外体 miRNA marker identified male fish and pseudo-rootless kit

[0033]Identification kit based on semen of semen exeracene piRNA marker PIR-MMU-72274 includes PIR-MMU-72274 quantitative detection primers, primer sequences are f: gcttggtgttcagtgt, R: TcgtatccagTGCAGGTC, PCR reverse transcription reagent and PCR fluorescent quantitative reagent, interconnected PIR as U6, primers U6-F: CTCGCTTCGGCAGCACATATACT; U6-R: ACGCTTCACGAATTTGCGTGTC; primer comprising a reverse transcription primer piR-mmu-72274-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAAGGCGAGA, furthermore kit comprises other conventional reagents quantitative PCR reactions: reverse transcriptase, Taq polymerase , DNTP, Buffer, MGCL2, DEPC water and anticipants. The reactive system of the kit is 10 ul system, namely 0.5 ul 10 * miRNA primer probe, 5 ul 2 * master mix, 2.5 ul DDH2O, 2 ulcDNA template. The Q6 real-time fluorescent quantitative PCR was detected using the q6 of Thermo Fisher, and the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An application of the sex tag piR-mmu-72274 of semi-smooth tongue sole, the sex tag piR-mmu-72274 is derived from fish seminal plasma exosomes, the present invention screens out the tag piRNAs significantly differentially expressed in two fishes through small RNA sequencing analysis as Candidates, through real-time quantitative PCR verification, finally determined the piRNA biomarkers that have an indicative effect on the two fish, the label piRNAs are piR-mmu-72274, and the sequence is GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT, and based on this, a detection kit was developed and prepared. The method of the invention has the advantages of non-invasiveness and high efficiency, and the identification result is reliable, and it is the first time that the genetic sex of the tongue sole is discriminated through quantitative detection.

Description

Technical field[0001]The present invention belongs to the field of fish biotechnology, and in particular, the application of a semi-slip tongue gender tag PIR-MMU-72274.Background technique[0002]Half-slip tongue (Cynoglossus Semilaevis) due to the huge differences between female, male fish growth and body type, and the proportion of male fish in breeding, the low economic value is low, and the industrial development is restricted by a certain degree. The study found that there was a great proportion of pseudo-roots in the male fish, ie genetically females, but the phenotype is a male fish. As a pseudo-rootless fish, the descendent will generate the characteristics of his father into pseudo-rootless fish, resulting in a high proportion of male fish. Therefore, the identification of pseudo-rootous fish is important for the semi-slip tongue breeding industry. Traditional female-specific microsatellite molecular marker method requires agarose electric swimbed strip identification, with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6879C12Q1/6851
CPCC12Q1/6851C12Q1/6879C12Q2600/158C12Q2600/178C12Q2531/113C12Q2561/101
Inventor 张博贾磊高磊赵娜刘克奉鲍宝龙李仰真车金远
Owner TIANJIN BOHAI SEA FISHERIES RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com