Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of sex label pir-xtr-979116 in tongue sole

A technology of pir-xtr-979116 and semi-smooth tongue sole, applied in the application field of semi-smooth tongue sole sex label piR-xtr-979116, to achieve reliable identification results

Active Publication Date: 2021-05-25
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In marine animals, there is almost no report on the research on exosome-derived piRNA as a biomarker. The present invention develops a method for the extraction and preliminary application of exosomes derived from fish seminal plasma represented by semi-smooth tongue sole, and solves the problem of semi-smooth tongue sole male fish and Discrimination of the Genetic Sex of Pseudo-Male Fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of sex label pir-xtr-979116 in tongue sole
  • Application of sex label pir-xtr-979116 in tongue sole
  • Application of sex label pir-xtr-979116 in tongue sole

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] A screening method for exosomal piRNA derived from semismooth tongue sole semen as a biomarker

[0020] 1. Collection of semen samples

[0021] Collect 0.5 ml of semen from sexually mature males of semi-smooth tongue sole in a centrifuge tube for the isolation and identification of exosomes.

[0022] 2. Extraction of exosomes

[0023] (1) Transfer 0.5ml semen sample to 1.5ml EP tube, place at 4°C, centrifuge at 1200g for 15min to remove sperm cells, centrifuge at 15000g at 4°C for 20min to remove small cell impurities and debris, dilute 1 times with PBS, and use 0.45um filter membrane Perform pre-filtration, and then filter the filtrate through a 0.22um membrane filter.

[0024] (2) Exosomes were extracted from the filtered samples using the Total Exosome Isolation Kit.

[0025] (3) Collect the lysate and transfer completely to an RNase-free 2ml tube.

[0026] 3. Identification of exosomes: Hitachi H600IV transmission electron microscope observation, after transmiss...

Embodiment 2

[0032] Kit for identification of male and pseudo-male by exosome miRNA markers in semismooth tongue sole semen

[0033] The identification kit based on semen exosome piRNA marker piR-xtr-979116 includes piR-xtr-979116 quantitative detection primers, the primer sequence is, F:TTAATCGGGTTCGTTTCCC, R:TCGTATCCAGTGCAGGGTC, PCR reverse transcription primer piR-xtr-979116-RT : GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGATGGTGCGT and reagents and qPCR fluorescence quantitative reagents, the internal reference piR is U6, the primer is U6-F: CTCGCTTCGGCAGCACATATACT; U6-R: ACGCTTCACGAATTTGCGTGTC; the kit primers include PCR reverse transcription primers, quantitative PCR forward primers and reverse primers, and other reagents The box contains other conventional reagents for quantitative PCR reactions: reverse transcriptase, Taq enzyme, dNTP, buffer, Mgcl 2, DEPC water and reference substance. The reaction system used in this kit is a 10ul system, that is, 0.5ul 10*miRNA primer probe, 5ul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An application of sex tag piR-xtr-979116 in half-smooth tongue sole, the sex tag piR-xtr-979116 is derived from fish seminal plasma exosomes, the present invention screens out the tag piRNAs with significant differential expression in two fishes as candidates through smallRNA sequencing analysis , through real-time quantitative PCR verification, finally determined the piRNA biomarkers that have an indicating effect on the two fishes, the tag piRNAs are piR-xtr-979116, and the sequence is CGGGTTCGTTTCCCGGCCAACGCACCA, and a detection kit was developed and prepared based on this. The method of the invention has the advantages of non-invasiveness and high efficiency, and the identification result is reliable, and it is the first time that the genetic sex of the tongue sole is discriminated through quantitative detection.

Description

technical field [0001] The invention belongs to the field of fish biotechnology, and in particular relates to the application of a sex tag piR-xtr-979116 in tongue sole. Background technique [0002] piRNA (Piwi-interactiing RNA) is a kind of non-coding RNA with a length of about 26-32nt (nucleotides). It was first discovered in 2006 by four independent research groups in the germline cells of Drosophila, mouse, rat and human. Find. Among all non-coding RNAs, piRNAs are the most numerous and mainly exist in the reproductive system. piRNAs serve as guides for PIWI, regulating the expression of target genes as well as modification at the transcriptional and post-transcriptional levels. piRNAs are different from miRNAs in their sequence characteristics and production methods. They are transcribed and processed from genome sequences and do not require Dicer cutting. Piwi binds to piRNA and enters the nucleus to participate in epigenetic regulation. There is evidence that it m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6879C12Q1/6888
CPCC12Q1/6879C12Q1/6888C12Q2600/178
Inventor 张博贾磊赵娜李坤明鲍宝龙刘克奉李仰真车金远
Owner TIANJIN BOHAI SEA FISHERIES RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com