Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene OsVAS1 capable of regulating ideal plant type of rice

An ideal rice technology, applied in genetic engineering, plant genetic improvement, recombinant DNA technology, etc., can solve the problems of in-depth and rare auxin research

Active Publication Date: 2019-01-01
HUAZHONG AGRI UNIV
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on auxin in rice is not deep, especially the reports on the relationship between auxin and ideal plant type are even rarer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene OsVAS1 capable of regulating ideal plant type of rice
  • Gene OsVAS1 capable of regulating ideal plant type of rice
  • Gene OsVAS1 capable of regulating ideal plant type of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] 1. Determination of the OsVAS1 candidate gene and the construction and transformation of the site-directed mutation vector of the gene

[0022] In order to study the synthesis mechanism of auxin in rice, the applicant made a homology comparison analysis of the amino acid sequence of the related homologous gene AtVAS1 in Arabidopsis in the rice database Rice Genome Annotation Project, and found that the amino acid sequence of LOC_Os01g08270 is homologous to The sex is the highest, reaching 66.5%. The gene was identified as the OsVAS1 gene in rice.

[0023] Then we used the CRISPR-P website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) to design the target site for CRISPR site-directed mutation of the gene, and entered the gene sequence or ID into the position indicated by the website The candidate target site sequence can be obtained, and finally we choose the target site sequence as follows: AGATGCAGGAATTGCTTCGAGGG, where the underlined part is the PAM (Protospace...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and specifically relates to a gene OsVAS1 capable of regulating the ideal plant type of rice. According to the present invention, the gene OsVAS1 simultaneously participating in rice auxin and ethylene synthesis pathways is cloned by using a candidate gene screening method, the plant type of rice can be improved and the yield can be increased through the site-directed mutation of the OsVAS1 gene by using a CRISPR technology, and biological function verification results prove the functions and the application ways of thegene; the nucleotide sequence of the gene OsVAS1 is represented by SEQ ID NO:1; the sequence of the protein encoded by the first transcript of the gene is represented by SEQ ID NO:3; and the sequenceof the protein encoded by the second transcript of the gene is represented by SEQ ID NO:5.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. Specifically, it relates to a gene OsVAS1 that regulates the ideal plant type of rice. The present invention adopts the candidate gene screening method to clone the gene OsVAS1 involved in the rice auxin and ethylene synthesis pathways at the same time, and finds that the OsVAS1 gene can be mutated by CRISPR technology, which can improve the rice plant type and increase the yield, and confirm the function and application of the gene way. Background technique [0002] The ideal plant type of rice was proposed by International Rice in the 1980s according to the actual needs of production, and achievements in related fields have been continuously produced and have attracted widespread attention. For example, OsIPA1, OsNPT1, etc. (Jiao et al., 2010; Miura et al., 2010; Wang et al., 2017); the ideal plant type mainly includes agronomic traits such as stem thickness, tiller number, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82
CPCC07K14/415C12N15/8261Y02A40/146
Inventor 赵云德张涛王荣臣
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com