Primer for identifying recessive white feather and colored feather isozygoty of Xianglu mountain chickens and application of primer

Abstract

The invention discloses a primer for identifying recessive white feather and colored feather isozygoty of Xianglu mountain chickens and application. Two pairs of primers, i.e., three primers, are adopted; two upstream primers are F1 and F2 respectively and one downstream primer is R; the upstream primer F1 and the downstream primer R are TYR gene ALV insertion sequence primers; the upstream primerF2 and the downstream primer R are TYR gene non-insertion sequence primers, wherein a primer sequence of the upstream primer F1 is as follows: 5'CGTTAAGCGAGACGGATGAGG 3'; a primer sequence of the upstream primer F2 is as follows: 5'AAGTTGTTGGAGGCTGGGTAT 3'; a primer sequence of the downstream primer R is as follows: 5'AGGCACAAGGAGTGGGACAGC 3'. The primer is used for identifying the recessive white feather and colored feather isozygoty of the Xianglu mountain chickens. The primer disclosed by the invention has the characteristic of rapidly and accurately identifying colored feather isozygoty and recessive homozygous individuals of the Xianglu mountain chickens.

Description

technical field [0001] The invention relates to a primer for homozygous identification of recessive white feathers and colored feathers of Xianglu pheasant and an application thereof, belonging to the technical field of gene molecular identification. Background technique [0002] The Xianglu pheasant is a primitive chicken breed formed under the long-term closed natural conditions of the Xianglu Mountain after the Miao people in the Kaili area migrated from the Central Plains to the southwest. The main wing feathers of the hen have flaky black feathers, and the tail has black feathers. Most of the feathers are sunflower-shaped. The back feathers of the rooster are brownish red, and the tail feathers are black with green luster. In Xianglu pheasant breeding, white feather chickens appeared in the population, and it was found that it was a recessive white feather. Because it did not change the feather color when crossed with colored feather homozygous chickens, it resulted in ...

AI Technical Summary

Problems solved by technology

[0004] The molecular mechanism of recessive white feather formation is: the formation of recessive white feather is due to the insertion of a 7.7kp endogenous leukemia virus ALV sequence in the fourth intron region of TYR (tyrosinase gene), resulting in TYR gene transcripts The transmembrane domain lacking the fifth exon in the

As a result, tyrosinase loses its normal functional activity, resulting in the inability to synthesize melanin, resulting in the formation of chicken white feathers

Images