Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers

A technology for entry-exit and kits, applied in biochemical equipment and methods, microbiological measurement/inspection, etc., can solve the problems of slow inspection speed, complicated inspection methods, and inaccurate results, and achieve non-degradable, easy extraction, and preparation simple effect

Active Publication Date: 2018-12-11
赵风源
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the above-mentioned shortcoming of the prior art, the purpose of the present invention is to provide a kind of test kit for fast detection of prohibited ingredients in the leather goods carried by passengers entering and exiting the country, mainly based on the LAMP amplification reaction system and colloidal gold test strip two technologies, the kit is used to solve the problems of slow inspection speed, complicated inspection methods and inaccurate results in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers
  • Kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers
  • Kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The primer set design and selection of the kit for rapidly detecting prohibited components in leather goods carried by inbound and outbound passengers

[0042] 1. Design primers:

[0043] (1) Retrieve the cat's Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 8)

[0044] (2) Retrieve the dog's Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 7)

[0045] (3) Retrieve the Cytb gene sequence of sheep from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 9)

[0046] (4) Retrieve the Cytb gene sequence of cattle from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 10)

[0047] (5) Retrieve the horse Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 11)

[0048] (6) According to the above sequence, the MEG software ...

Embodiment 2

[0066] LF

[0067] ATATAGAAGCTCCGTTGGCGTGT

[0068] LB

[0069] CTTCTCAGAGACATGAAACATTGGA

[0052] Primer set 2:

[0053] [0072] Primer

[0073] Sequence (5'→3')

[0074] F3

Embodiment 3

[0076] B3

[0077] GGAGCCGTAGTACATTCC

[0078] FIP

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers. The kit comprises a sample treatment system, an LAMP amplified reaction system, a nucleic acid immunization colloidal gold test strip, a positive control and a negative control. A detection step mainly comprises the following steps of extraction of DNA of a sample to be tested, preparation of an LAMP detection reaction system of the sample to be tested, LAMP amplified reaction and testing with the nucleic acid immunization colloidal gold test strip. The kitis simple, convenient, rapid and accurate to operate with low cost, can detect the dog-derived components and also the cat-derived components, can effectively distinguish other ruminant animal origins, such as dogs, cats and horses, commonly used as leather product raw materials, is high in specificity to detection of animal origins in leather products, can ensure the specificity and the sensibility of detection through nucleic acid amplification, realizes intuition, the simplicity and the convenience through immobilized colloidal gold detection and is very suitable for being used for exit and entry port inspection and quarantine personnel to perform field detection.

Description

Technical field [0001] The present invention relates to a new means for detecting prohibited components carried by passengers at entry and exit checkpoints, in particular to a kit for quickly identifying the components of dog skins and cat skins carried by entry and exit passengers. Background technique [0002] According to the "Cats and Dogs Protection Act" promulgated by the United States in 2000, the United States prohibits the import of cats and dogs' fur, and a fine of up to 10,000 U.S. dollars will be imposed for this practice. Beginning in 2018, my country has also gradually issued a series of legal provisions prohibiting the import and sale of leather shoes, leather clothing and other leather goods made of dog and cat leather, and all suspected leather goods are required to provide non-cats and dogs issued by relevant agencies of the other country. Proof of source raw materials, all that cannot be provided shall be returned for processing. However, with the continuous ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2531/119C12Q2565/625C12Q2545/113
Inventor 赵风源胡平王通艳
Owner 赵风源
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More