Peptides and their preparation and use
A host cell and sequence technology, applied in the field of genetic engineering, can solve the problems of limited chemical synthesis, limited wide use, high cost and other problems of the preparation method, and achieve the effects of broad market application prospect, low production cost and low cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Example 1: Construction and expression of pET-32a-M11-2 gene expression vector
[0071] (1) Construction of Escherichia coli Genetic Engineering Bacteria
[0072] 1.1. Since the expression efficiency of the polypeptide can be significantly improved by expressing the M11 polypeptide gene in tandem, this embodiment selects n=2, that is, M11-2 with 2 repeats, and its amino acid sequence is GMPFRWFKPVNGMPFRWFKPVN (SEQ ID No.2).
[0073] 1.2. According to the amino acid sequence of M11-2, the preferred codon gene of Escherichia coli was optimized and selected, that is, ggcatgccgtttcgctggttcaaaccggtgaacggcatgccgtttcgctggtttaaaccggtgaac (SEQ ID No. 6). In order to meet the requirements of subsequent polypeptide digestion, the 5' end of this gene was added with AAT (hydroxyaminase cutting site), and TAA (stop codon) is added to the 3' end, and the complete gene is aat ggcatgccgtttcgctggttcaaaccggtgaacggcatgccgtttcgctggtttaaaccggtgaac taa (SEQ ID No.7) (synthesized by GENEWI...
Embodiment 2
[0085] Example 2: Human Trial of Whitening Short Peptide M11
[0086] The whitening short peptide M11 was sterilized by filtration with a 0.22 μm membrane, diluted with purified water to 40 μg / mL, and stored in the refrigerator for later use.
[0087] 40 volunteers (20 males, 20 females, aged 23-45 years old) were randomly divided into two groups, A and B, 20 in each group (10 males, 10 females), the left face of volunteers in group A was tested 7ml of 40μg / mL whitening short peptide M11, 7ml of pure water was used on the left face of volunteers in group B, and the right face was used as a blank control group. During the experiment period, other whitening cosmetics were stopped, and the melanin content was measured after continuous use for 7 days.
[0088] Method reference: "Cui Huanlian, Cao Rui, Yin Jiazhen, etc. Efficacy Evaluation of Whitening Cosmetics [J]. Fragrance and Fragrance Cosmetics, 2012, 4(2):37-40" (which is incorporated herein by reference), by MX 18 skin p...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com