Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant E.coli (Escherichia coli) and application thereof

A technology for recombining Escherichia coli and Escherichia coli, which is applied in applications, recombinant DNA technology, bacteria, etc., can solve the problems of VC loss of reducing activity, limited application, VC instability, etc.

Active Publication Date: 2018-11-30
ZHEJIANG UNIV OF TECH
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, VC itself is unstable, and the enol-type hydroxyl groups on the 2- and 3-carbon atoms in the molecule are easily oxidized and dissociated, which makes VC lose its reducing activity, thus limiting its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant E.coli (Escherichia coli) and application thereof
  • Recombinant E.coli (Escherichia coli) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of recombinant Escherichia coli E.coli IEF-blsp101 containing L-ascorbic acid glycosylase gene

[0027] Genomic DNA of bifidobacterium longum (Bifidobacterium longum) IEF101 in the mid-logarithmic growth phase was extracted using a bacterial genomic DNA extraction kit, and used as a template to perform PCR amplification with the following primers:

[0028] bloSP-F:

[0029] GCCTGGTGCCGCGCGGCAGCCATATGAAAAACAAAGTGCAACTCATC;

[0030] bloSP-R:

[0031] GTCGACGGAGCTCGAATTCGGATCCTTAGTCGATATCGGCAATCGG.

[0032] The high-efficiency fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme Biotech Co., Ltd. was used for PCR amplification. The PCR amplification program was: 95°C for 3min; 95°C for 15s, 58°C 15s at ℃, 1.5min at 72℃, 30 cycles; 5min at 72℃.

[0033] The obtained PCR product was purified using a PCR product recovery kit, and cloned between Nde I and BamHI of the pET28a+ plasmid using the One Step Cloning Kit of Nanjing Novizan Bio...

Embodiment 2

[0035] Embodiment 2, preparation produces the fermented broth bacterial agent of AA-2G

[0036] The E.coliIFE-blsp101 prepared in Example 1 was cultured in a seed medium containing 50 μg / mL kanamycin at 37° C. and 200 rpm to the mid-logarithmic growth phase to obtain a seed solution.

[0037] Inoculate the freshly cultivated seed liquid into the fermentation medium containing 50mg / L kanamycin at an inoculum volume concentration of 5%, culture at 35°C for 5h, add a final concentration of 10g / L α-lactose, and control the fermentation temperature at 23°C , the dissolved oxygen DO is controlled to be greater than 20%, the fermentation pH is controlled to 6.8 with 25% ammonia water, and the fermentation is continued for 12 hours to obtain a fermented liquid with a wet cell content of 30g / L as a catalyst.

[0038] Dilute the fresh fermentation broth 3 times with deionized water, so that the content of wet bacteria is 10g / L. After crushing the cells with a high-pressure cell homogeni...

Embodiment 3

[0039] Application of embodiment 3 bacterial agents in the production of AA-2G

[0040] 1. Detection of catalytic activity of fermentation broth

[0041] Centrifuge the fermented broth prepared by the method in Example 2, take 0.5 g of wet bacterial cells and resuspend them in 50 mL of pH 5.2, 50 mM sodium citrate buffer, break the bacterial cells with a high-pressure homogenizer, and add a final concentration of 210 g / 1L of VC and 270g / L of sucrose constitute a 50ml reaction system. The catalytic reaction was stirred in a water bath at 40°C for 12h. The reaction solution was used for HPLC analysis. The residual substrate VC concentration was measured to be 164g / L, and the formed product AA- The concentration of 2G is 30g / L.

[0042] Liquid chromatography detection conditions: sample pretreatment, take 50 μL of reaction solution, add it to 950 μL of 0.01mol / L dilute hydrochloric acid, filter it with a 0.22 μm filter membrane, add the filtrate to the liquid phase sample bottl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant E.coli (Escherichia coli) and application thereof. The recombinant E.coli is obtained by transferring an L-VC (Vitamin C) glycosylase gene sourced from bifidobacterium longum IEF101 as shown in SEQ ID NO.1 into Escherichia coli host cells. A single glycosylated product AA-2G (2-0-alpha-D-glucosyl-L-VC) is efficiently produced by adopting a biological method through one-step catalytic conversion; the recombinant E.coli IEF-blsp101 is capable of efficiently synthesizing sucrose phosphorylase in cells, glycosylation reaction of the L-VC can be efficiently catalyzed by taking the L-VC and saccharose as substrates, 90 to 100 g / L of the AA-2G can be obtained by catalyzing within 45 to 72 hours, and the average production intensity is greater than 1.3g.L<-1>.h<-1>.

Description

(1) Technical field [0001] The invention relates to a recombinant escherichia coli containing L-ascorbic acid glycosylase gene and its application for producing 2-O-α-D-glucosyl-L-ascorbic acid (AA-2G). (2) Technical background [0002] L-Ascorbic acid (VC) is a common water-soluble vitamin and an essential nutrient element for the human body. Its structure is as follows: figure 1 shown. Lack of VC can cause scurvy, heart disease, cancer and other diseases. Because the human body cannot synthesize VC, it must be obtained from food. In addition, it can also be used as flavoring agent, reducing agent, antioxidant, bleaching agent, etc., and is widely used in the fields of food, cosmetics and medicine. However, VC itself is unstable, and the enol hydroxyl groups on the 2- and 3-carbon atoms in the molecule are easily oxidized and dissociated, which makes VC lose its reducing activity, thus limiting its application. [0003] L-ascorbic acid derivatives mainly include metal sa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/56C12N15/70C12P19/60C12R1/19
CPCC12N9/24C12N15/70C12P19/60
Inventor 陈小龙朱林江陆跃乐范永仙周瑶瑶张辉沈寅初
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com