Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Paddy rice exogenous stress induction expression promoter Psubs3 and application thereof

A technology of inducing expression and promoter, applied in the fields of biotechnology and plant genetic engineering, can solve the problems affecting the normal growth and development of plants, waste of material and energy, etc. Effect

Active Publication Date: 2018-11-13
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While the gene is highly expressed, it also causes waste of material and energy in the process of plant growth, and even the normal growth and development of the plant is affected due to the accumulation of exogenous genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paddy rice exogenous stress induction expression promoter Psubs3 and application thereof
  • Paddy rice exogenous stress induction expression promoter Psubs3 and application thereof
  • Paddy rice exogenous stress induction expression promoter Psubs3 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Step 1, promoter Psubs3 cloning and pCAMBIA1381-Psubs3 vector construction

[0035] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI, the amplification primers were designed according to the sequence in the sequence table SEQ ID No.1, and the primers were designed according to the characteristics of the selected vector and target gene. Restriction sites. Primers used for amplification were:

[0036] Forward primer: EcoRI GAATTCTTTACTCACCGTGTCCTCTGTT

[0037] Reverse primer: HindIII AAGCTTTGTATCTCCTCTCTGGTAGTTAG

[0038] Using the rice variety Nipponbare DNA as a template, using the forward primer and reverse primer to amplify the promoter Psubs3, according to the conventional PCR system, the following amplification procedure was adopted:

[0039] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 2min and 30s, 35 cycles from pre-denaturatio...

Embodiment 2

[0052] 1. Obtaining the POssalt2 promoter containing restriction sites

[0053] (1) Design of primers

[0054] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI. Amplification primers are designed according to the promoter sequence of SEQ ID No.2 in the sequence table, and restriction enzyme cutting sites of the primers are designed according to the characteristics of the selected vector and target gene. In this example, the rice binary expression vector pCAMBIA1381 (from pCAMBIA, a publicly available vector, preserved by the Rice Group of the Supervision, Inspection and Testing Center for Components of Transgenic Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences) is taken as an example. The target gene is the GUS gene. Specifically designed The primer sequences are as follows, the bases in italics are restriction sites:

[0055] Forward primer: GAATTCAATTCCTACTACTTAAATTCCAEco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a paddy rice exogenous stress induction expression promoter Psubs3 and application thereof. Sequences of the paddy rice exogenous stress induction expression promoter Psubs3 arenucleotide sequences shown as SEQ ID No:1. The invention further provides an exogenous induction expression promoter. Sequences of the exogenous induction expression promoter are shown as SEQ ID No:2. The paddy rice exogenous stress induction expression promoter Psubs3 and the exogenous induction expression promoter can be particularly applied to plant transgenic engineering. The paddy rice exogenous stress induction expression promoter Psubs3, the exogenous induction expression promoter and the application have the advantages that exogenous genes can be promoted by the paddy rice exogenous stress induction expression promoter Psubs3 and the exogenous induction expression promoter to be expressed in plants in flooding or salty environments, the paddy rice exogenous stress induction expression promoter Psubs3 and the exogenous induction expression promoter are applicable to optional plants, the exogenous genes can be particularly driven to be expressed in paddy rice plants in an induction manner, accordingly, the paddy rice exogenous stress induction expression promoter Psubs3 and the exogenous induction expression promoter can be used for enhancing and improving growth characteristics of paddy rice in flooding environments, and perfect paddy rice varieties can be bred.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to a rice exogenous stress-induced expression promoter and its application. Background technique [0002] Rice is a food crop widely distributed in southern my country. Flood disasters generally occur from April to July, with heavy rainfall and long periods of time. The growth of early rice is easily affected by it, resulting in a large area of ​​rice flooding, a decline in yield, and in severe cases, even crop failure in some areas, affecting my country's food security. [0003] As a semi-aquatic plant, rice can tolerate a certain degree of flooding, but different rice varieties have different tolerances to complete flooding. Most rice varieties are very sensitive and will die within a week of flooding, but there are some species that can survive weeks of complete flooding. Therefore, the study of the flood toler...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/82A01H5/00A01H6/46
CPCC12N15/8237C12N15/8271C12N15/8273C07K14/415
Inventor 秦瑞英杨亚春李娟李浩魏鹏程杨剑波
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com