Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Esophageal cancer prognosis biological marker and detection method and application thereof

A biomarker and detection method technology, applied in biochemical equipment and methods, microbiological determination/inspection, etc., can solve the problems of poor clinical application effect, high detection cost, time-consuming and labor-intensive detection process, etc., and achieve convenient and rapid detection , The experimental process is simple, and the effect of a wide range of applications

Active Publication Date: 2018-11-06
徐建震
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a novel esophageal cancer prognostic marker and its detection method to solve the problems of time-consuming and labor-intensive detection process of the existing method, high detection cost and poor clinical application effect.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Esophageal cancer prognosis biological marker and detection method and application thereof
  • Esophageal cancer prognosis biological marker and detection method and application thereof
  • Esophageal cancer prognosis biological marker and detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Two sets of gene expression profile data (GSE89102 and GSE100942) were downloaded from the Gene Expression Omnibus database. GSE89102 contained 5 esophageal squamous cell carcinoma patient samples and their adjacent tissue expression profile data, and GSE100942 contained 4 esophageal squamous cell carcinoma patient samples and their adjacent tissue. Tissue expression profiling data. After analyzing the two sets of expression profiles, it was found that the expression of TRA2A gene in esophageal squamous cell carcinoma tissue was significantly higher than that in adjacent tissue (GSE89102p=0.024; GSE100942, p=0.064) ( figure 1 ). At the same time, the data of 194 esophageal samples from the TCGA database were analyzed (184 cases of esophageal cancer, including 89 cases of esophageal adenocarcinoma, 95 cases of esophageal squamous cell carcinoma, and 10 cases of adjacent cancer), the same TRA2A mRNA expression was highly expressed in esophageal cancer, and in Higher expr...

Embodiment 2

[0040] Esophageal cancer patients and adjacent normal control tissues were collected, and DNA and RNA in each sample were extracted with a DNA / RNA AllPrep (Qiagen) kit. The total amount of DNA is greater than 7 μg, and the total amount of RNA is greater than 5 μg. Use RNA6000Nano assay (Agilent) to detect RIN (RNA Integrity Number) ≥ 7.0. DNA samples were detected using the Affymetrix SNP 6.0 chip platform, and the GISTIC 2.0 algorithm was used to analyze gene copy number variation analysis; RNA samples were sequenced using the IlluminaHiSeq2000PE75 platform, and the BWA algorithm was used to compare the reference genome. The number of reads in base length) represents the amount of gene expression.

[0041]The data of 184 cases of esophageal cancer samples from TCGA were obtained according to the above-mentioned experimental method. Among them, 12% of 23 patients had TRA2A gene changes including amplification, censoring, and mRNA up-regulation. Among them, 12 cases of esoph...

Embodiment 3

[0043] Interfering with TRA2A inhibits cancer progression in esophageal cancer

[0044] In order to further confirm the role of TRA2A in the process of esophageal cancer, two siRNAs, TRA2AsiRNA#1 and TRA2A siRNA#2, were designed to interfere with TRA2A mRNA. At the same time, 48 hours after transient transfection of siRNAs in esophageal cancer cells TE1, the cells were collected, RNA was extracted by Trizol reagent, cDNA was synthesized with Takara’s PrimeScript reverse transcription kit, and Takara’s real-time quantitative kit (RR420A) was used with TRA2A-specific primers , the expression level of TRA2A gene messenger RNA was detected by Real time-PCR experiment, so as to verify the interference efficiency of siRNA.

[0045] TRA2A specific primers are:

[0046] 5' end primer CTCCAATGTCTAACCGGAGAAGA

[0047] 3' end primer TTGACACCACTCAATGGTCCA.

[0048] In TE1 cells transfected with TRA2A siRNA#1, the expression level of TRA2A mRNA was 44% compared with the control group, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a esophageal cancer prognosis biological marker and a detection method and an application thereof, wherein the biological marker is RNA binding protein TRA2A, and the amino acid sequence is shown in SEQ ID NO: 1; the DNA sequence is shown in SEQ ID NO: 2. The detection method of the esophageal cancer prognostic biological marker mainly comprises two detection methods whichare an mRNA expression change detection and an mRNA expression change detection combined with a gene mutation detection. The detected samples comprise tissues and organs. The biological marker can beused for preparing esophageal cancer diagnostic reagent and / or medicine. The esophageal cancer prognostic biological marker can commonly be used for two main esophageal cancers which are the esophageal adenocarcinoma and the esophageal squamous cell carcinoma, and the detection of the esophageal cancer prognostic biological marker is convenient and rapid, the experiment process is simple and theresult is clear. Except the TRA2A primer, the used reagents are mostly common reagents and the cost is low.

Description

technical field [0001] The invention belongs to the fields of biotechnology and biomedicine, and relates to a marker related to the prognosis of esophageal cancer and its application. Background technique [0002] Esophageal cancer is a common malignant tumor of the upper gastrointestinal tract. my country is the main country with high incidence of esophageal cancer in the world. Statistics show that the incidence of esophageal cancer is increasing rapidly year by year. The incidence rate of esophageal squamous cell carcinoma varies greatly in different regions. In Turkey, Kazakhstan, northeastern Iran, southern and central China, the annual incidence rate exceeds 1 / 1000, and the incidence rate in southern and eastern Africa is also low. very high. The five-year survival rate of patients with esophageal cancer is only 15%-25%. One of the reasons is that the prognosis of esophageal cancer is still based on clinical and pathological methods, lacking molecular biomarkers. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/156C12Q2600/158
Inventor 徐建震杨德印赵星
Owner 徐建震
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com