Display system of chitosanase cell surface and preparation and application thereof
A technology of chitosan enzyme and cell surface, which is applied in the field of bioengineering, can solve the problems of complex chitosan oligosaccharide process and difficult separation of chitosan and reaction products, and achieve the effect of saving cumbersome steps and reducing costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] 1. Cloning of csn and inaQN gene fragments
[0047] According to the published Bacillus subtilis chitosanase gene sequence design primer (called P1 and P2) according to the National Biotechnology Information Center of the United States, according to the gene sequence of the inaQ published in GenBank, design primer (called P3 and P4), respectively Using the genomic DNA of Bacillus subtilis and Pseudomonas syringae MB03 as templates, PCR amplification was carried out to obtain the csn gene fragment and the inaQN gene fragment respectively.
[0048] P1(5'→3'): AGATCT GCGGGACTGAATAAAGATC
[0049] P2(5'→3'): GAATTC TTATTTGATTACAAAATTACCG
[0050] P3(5'→3'): CCATGG ATCTCGACAAGGCG
[0051] P4(5'→3'): AGATCT GGTCTGCAAATTCTGCGG
[0052] Primers P1 and P4 contain a Bgl II restriction site, primer P2 contains an EcoR I restriction site, and primer P3 contains a Nco I restriction site.
[0053] The PCR reaction conditions were: pre-denaturation at 94°C for 3 min; denatu...
Embodiment 2
[0061] The average relative molecular mass is 4.1×10 5 Da chitosan was prepared into a 0.1% solution with acetic acid-sodium acetate buffer solution of pH 6.0, and the above-mentioned spare bacterial suspension was centrifuged at 12000×g for 2 min at 4°C, and the supernatant was discarded, suspended in the same volume of the above-mentioned 0.1 % chitosan solution, react in a oscillating constant temperature water bath at 30-37°C, use the viscosity method to detect the relative molecular weight every 20 minutes, and react for 2 hours. After 100 minutes of reaction, the relative molecular weight of chitosan changes from the initial 4.1×10 5 Da down to 5.0×10 3 Da left and right. Such as Figure 4 shown. It can be seen that the degradation efficiency of chitosan is high and the speed is fast.
PUM
Property | Measurement | Unit |
---|---|---|
Average relative molecular weight | aaaaa | aaaaa |
Relative molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap