Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer pair for detecting expression quantity and relative expression quantity of human C9ORF98 gene

A C90RF98-P, relative expression technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of no detailed description of functions, etc., to facilitate interpretation and reduce detection costs. , the effect of improving the efficiency of the experiment

Inactive Publication Date: 2018-06-29
SUZHOU GENOARRAY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] C9ORF98 is a newly discovered gene in recent years, and its function has not yet been described in detail

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair for detecting expression quantity and relative expression quantity of human C9ORF98 gene
  • Primer pair for detecting expression quantity and relative expression quantity of human C9ORF98 gene
  • Primer pair for detecting expression quantity and relative expression quantity of human C9ORF98 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The kit for detecting the relative expression of C9ORF98 gene of the present invention comprises:

[0046] TRIzol (Shanghai Jierui Biological Engineering Co., Ltd.);

[0047] Chloroform;

[0048] Anhydrous ethanol;

[0049] ReverTranscript qPCR RT Kit (Takara);

[0050] Detection system PCR reaction solution: qPCR Mix (2×) (Beijing TransGen Biotech Co., Ltd.), C9ORF98-F / C9ORF98-R 0.2 μM each

[0051] Among them, the primer sequence is:

[0052] C9ORF98-F: TCACACCCAGACACGTCATT (Sequence 1)

[0053] C9ORF98-R: TTCTGGATTTCAGATTCGGG (sequence 2)

[0054] GAPDH-F: CATGAGAAGTATGACAACAGCCT (Sequence 3)

[0055] GAPDH-R: AGTCCTTCCACGATACCAAAGT (SEQ ID NO: 4)

Embodiment 2

[0057] The using method of kit of the present invention:

[0058] (1) Extracted tissue RNA: Take an appropriate amount of fresh tissue, add 1mL trizol to the homogenate and grind evenly, add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10min, absorb the supernatant layer and transfer to another new centrifuge into the tube; add an equal volume of isopropanol, mix well up and down, and let stand at room temperature for 10 minutes; centrifuge at 14,000 rpm at 4°C for 10 minutes, discard the supernatant, add 1ml of 75% ethanol, and wash the tube wall upside down gently; centrifuge at 14,000 rpm at 4°C for 5 minutes, Discard ethanol; dry at room temperature for 10-15min, add 20ul RNase-free water to dissolve the precipitate.

[0059] (2) Referring to the instructions of the ReverTranscript qPCR RT Kit kit from Takara Company, the RNA was reversed into cDNA to obtain a cDNA solution, and the concentration of cDNA in the cDNA solution was 50 μL / μL.

[0060] (3) Re...

Embodiment 3

[0065] Using the nucleic acid detection kit of the present invention to detect clinical specimens

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer pair for detecting an expression quantity and a relative expression quantity of a human C9ORF98 gene. The primer pair, which is disclosed by the invention, for detecting the expression quantity and the relative expression quantity of the human C9ORF98 gene is a primer pair which is named by C90RF98-P and consists of a single-chain DNA as shown in a sequence 1 and asingle-chain DNA as shown in a sequence 2 in a sequence table.Experiments show that the primer pair disclosed by the invention can detect the expression quantity of C9ORF98 in a liver cancer tissue,and is relatively easy to operate and accurate in results.

Description

technical field [0001] The invention relates to a pair of primers for detecting the expression level and relative expression level of human C9ORF98 gene in the field of biotechnology. Background technique [0002] Liver cancer is a digestive system tumor with a high mortality rate, 90% of which are hepatocellular carcinoma (HCC). Worldwide, its incidence is on the rise. my country is a large country with liver cancer, and it is also the country with the highest incidence rate of liver cancer in the world. According to statistics, the incidence of liver cancer in my country accounts for 55% of the world's total, and the death toll accounts for about 45% of the world's liver cancer deaths. It is known as the "king of cancer" and poses a serious threat to the health of our people. At present, AFP is mainly used clinically as a marker for the diagnosis of liver cancer, but it is easy to cause misdiagnosis due to the influence of hepatitis and cirrhosis. Therefore, it is very ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851C12N15/11
CPCC12Q1/6886C12Q1/6851C12Q2600/158C12Q2600/166C12Q2545/114
Inventor 张函槊李娟李绍路
Owner SUZHOU GENOARRAY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More