Primer pair for detecting expression quantity and relative expression quantity of human C9ORF98 gene
A C90RF98-P, relative expression technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of no detailed description of functions, etc., to facilitate interpretation and reduce detection costs. , the effect of improving the efficiency of the experiment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] The kit for detecting the relative expression of C9ORF98 gene of the present invention comprises:
[0046] TRIzol (Shanghai Jierui Biological Engineering Co., Ltd.);
[0047] Chloroform;
[0048] Anhydrous ethanol;
[0049] ReverTranscript qPCR RT Kit (Takara);
[0050] Detection system PCR reaction solution: qPCR Mix (2×) (Beijing TransGen Biotech Co., Ltd.), C9ORF98-F / C9ORF98-R 0.2 μM each
[0051] Among them, the primer sequence is:
[0052] C9ORF98-F: TCACACCCAGACACGTCATT (Sequence 1)
[0053] C9ORF98-R: TTCTGGATTTCAGATTCGGG (sequence 2)
[0054] GAPDH-F: CATGAGAAGTATGACAACAGCCT (Sequence 3)
[0055] GAPDH-R: AGTCCTTCCACGATACCAAAGT (SEQ ID NO: 4)
Embodiment 2
[0057] The using method of kit of the present invention:
[0058] (1) Extracted tissue RNA: Take an appropriate amount of fresh tissue, add 1mL trizol to the homogenate and grind evenly, add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10min, absorb the supernatant layer and transfer to another new centrifuge into the tube; add an equal volume of isopropanol, mix well up and down, and let stand at room temperature for 10 minutes; centrifuge at 14,000 rpm at 4°C for 10 minutes, discard the supernatant, add 1ml of 75% ethanol, and wash the tube wall upside down gently; centrifuge at 14,000 rpm at 4°C for 5 minutes, Discard ethanol; dry at room temperature for 10-15min, add 20ul RNase-free water to dissolve the precipitate.
[0059] (2) Referring to the instructions of the ReverTranscript qPCR RT Kit kit from Takara Company, the RNA was reversed into cDNA to obtain a cDNA solution, and the concentration of cDNA in the cDNA solution was 50 μL / μL.
[0060] (3) Re...
Embodiment 3
[0065] Using the nucleic acid detection kit of the present invention to detect clinical specimens
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap