Palaemon carinicauda embryo micro-injection method and building of mRNA overexpression model by using method
A technology of microinjection and white shrimp, applied in the field of gene editing, can solve the problems of lack of research on gene editing of crustaceans
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: Microinjection method of white shrimp embryo
[0020] 1) Selection of spinytail shrimp and fertilized eggs
[0021] In the microinjection experiments, the shrimps used were healthy adult white shrimp (E. carinicauda), with an average body length of 5.5±0.5 cm. The shrimps used in the experiment were continuously aerated and cultured in natural seawater. The water was changed and bait was fed every day. The water temperature was maintained at 24°C. The white shrimp with mature gonads was selected for the experiment. According to the characteristics of each developmental stage of fertilized eggs of white shrimp, combined with the success rate of microinjection experiments, the injection success rate before the 8-cell stage is relatively high, and the injection survival rate at the single-cell stage is the highest; injection after the 8-cell stage is difficult, and the injection needle is easy to use. broken; therefore, the selection of fertilized eggs at th...
Embodiment 2
[0031] Example 2: Construction of a model by microinjection of spinytail shrimp embryos
[0032] (1) Construction of SP6-EGFP DNA template
[0033] The EGFP sequence was inserted between the multiple cloning sites EcoR I and Not I of the commercialized plasmid pIZT / V5-His (Invitrogen, USA) to construct the pIZT / V5-EGFP recombinant plasmid. According to the sequence of pIZT / V5-EGFP, the forward primer SP6-EGFP-F and the reverse primer SP6-EGFP-R were designed, and the SP6 promoter site was added in the forward primer.
[0034] The primer sequences are as follows:
[0035] SP6-EGFP-F:gc ATTTAGGTGACACTATAGAAACAG ATGGTGAGCAAGGGCGAGGA (single underline is the SP6 promoter sequence)
[0036] SP6-EGFP-R: CGCGCTTGAAAGGAGTGTGTA
[0037]Use primers SP6-EGFP-F and SP6-EGFP-R to amplify the EGFP sequence in the pDHSP70-EGFP-His plasmid, and the PCR reaction system is:
[0038]
[0039] PCR cycle program such as: 98°C pre-denaturation for 1min; 98°C for 10sec, 59°C for 5sec, 72°C ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com