Araneus ventricosus wrapped fibroin full-length gene and preparation method thereof
A technology for full-length genetic, large-bellied garden spiders
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] (1) According to the conserved sequence at the NT end of the AcSp of other spiders, design a degenerate primer at the NT end and CT end respectively: NT end degenerate primer: TGTTTYCARGCNGTNATG, and design a specific reverse primer at the repeat region, Specific reverse primer: GCACCACTGGTCTGAGAGAAC; then perform PCR under the conditions of pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30s, annealing at 55°C for 30s, extension at 72°C for 30s, and 30 cycles.
[0044](2) According to the obtained sequence, two specific primers and one anchor primer were designed respectively at the NT end and CT end to complement the NT end and CT end.
[0045] NT end-specific primer 1: GACTTGTTGCTTGAAACGATGCTG;
[0046] NT end-specific primer 2: GCAGAGAAAAGCTCCTTGGTCTTG;
[0047] Anchor primer: ACTCCTGTGGAACC ATCGGACGGGGGG;
[0048] The anchor PCR conditions are: in the first round of PCR, use specific primer 1 for single primer amplification, conditions: pre-denat...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap