Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Iris ensata thumb cysteine-rich protein gene IlCDT1 as well as plant expression vector and construction method thereof

A technology for plant expression vectors and protein enrichment, which is applied in the field of IlCDT1, the cysteine-rich protein gene IlCDT1 of Sinus chinensis and its plant expression vector and construction, to achieve the effect of plant variety improvement and heavy metal resistance

Inactive Publication Date: 2017-11-21
INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the present invention is to provide a new plant cysteine-rich protein gene IlCDT1 , solve the problem of improving the heavy metal resistance of Iris plants and repairing heavy metal pollution in soil,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Iris ensata thumb cysteine-rich protein gene IlCDT1 as well as plant expression vector and construction method thereof
  • Iris ensata thumb cysteine-rich protein gene IlCDT1 as well as plant expression vector and construction method thereof
  • Iris ensata thumb cysteine-rich protein gene IlCDT1 as well as plant expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 IlCDT1 clone

[0029] Choose Ma Lin ( Iris lactea var. chinensis ) as material, with 100 µM CdCl 2 Treat the Iris seedlings, take the roots 24 hours later, extract the total RNA from the roots according to the instructions of the Trizol RNA Extraction Kit (TaKaRa), and reverse transcribe 1 μg of the total RNA into cDNA.

[0030] Using the extracted leaf cDNA as a template, design primers IlCDT1-F and IlCDT1-R for PCR reaction:

[0031] Upstream primer IlCDT1-F: ATGTATCCACCACCATCAGCA (SEQ ID NO.4)

[0032] Downstream primer IlCDT1-R: GAGCAGATTTGAATGCCTAA (SEQ ID NO.5)

[0033] 50 μL reaction system: 10×RCR Buffer 5.0 μL, IlCDT1-F, IlCDT1-R primers 1.0 μL each (20 μmol L -1 ), dNTP mix 4.0 μL (2.5 mmol·L -1 ), Taq DNA Polymerase 0.2 μL, cDNA template 1 μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95 °C for 4 min, then melting at 94 °C for 30 sec, annealing at 55 °C for 30 sec, extension at 72 °C for 2 min, 32 cycles of reaction, and ext...

Embodiment 2

[0034]Example 2. Construction of plant expression vector pMDC43-IlCDT1

[0035] Design primers IlCDT1-ZF, IlCDT1-ZR for PCR reaction, in the target gene IlCDT1 Respectively introduce enzyme cutting sites upstream and downstream Bam HI and not I, the PCR product is connected to the pMD19-T Simple vector, transformed into TOP10 competent cells, and the positive plasmid is extracted, Bam HI and not I double digested IlCDT1 fragment with Bam HI and not I double-digested pENTRY1A ligated, transformed, extracted the positive plasmid pENTRY1A-IlCDT1, recombined into the expression vector pMDC43 after pENTRY1A-IlCDT1 linearization, extracted the positive plasmid, detected by electrophoresis and sequenced to verify that it was SEQ ID NO.1, specifically Proceed as follows:

[0036] Upstream primer IlCDT1-ZF: CGCGGATCCGGATGTATCCACCACCATCA (SEQ ID NO.2)

[0037] Downstream primer IlCDT1-ZR: TTGCGGCCGCGATACAGCAGCAGCATAG (SEQ ID NO.3)

[0038] (1) Using the root cDNA as a tem...

Embodiment 3

[0041] Example 3 Plant expression vector pMDC43- IlCDT1 Genetic transformation of Arabidopsis thaliana and identification of its resistance to heavy metals

[0042] (1) Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105

[0043] Pick a single colony of EHA105 from the YEB (50 ug / mL rifampicin) plate, inoculate it in 50 mL YEB liquid medium containing 50 ug / mL rifampicin, cultivate at 200 rpm at 28°C until the OD value is 0.5, and then Ice-bath the bacterial solution for 30 min, collect the bacterial cells by centrifugation, and suspend in 2 mL of pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200 uL / tube aliquoted for use. Take 10 uLpMDC43- IlCDT1 Carrier plasmid, add 200 uL EHA105 competent cells, ice bath for 30 min, freeze in liquid nitrogen for 5 min, 37°C for 5 min, add 800 uL YEB liquid medium, pre-cultivate at 28°C 200 rpm for 4 h, spread the bacterial solution on YEB (50 ug / mL rifampicin + 50 ug / mL kanamycin) on solid medium, cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and discloses an iris ensata thumb cysteine-rich protein gene IlCDT1 as well as a plant expression vector and a construction method thereof. The sequence of the iris ensata thumb cysteine-rich protein gene IlCDT1 is SEQ ID NO.1. IlCDT1 is a new heavy metal resistance gene, and the heavy metal resistance of plants can be improved by the gene. The plant expression vector of the iris ensata thumb cysteine-rich protein gene IlCDT1 is formed by the iris ensata thumb cysteine-rich protein gene IlCDT1 and a plant expression vector. The plant expression vector of IlCDT1 is reported for the first time; the plant expression vector can be directly used for genetic transformation mediated by agrobacterium tumefaciens and creating a new heavy metal resistance germplasm, so that the heavy metal resistance of the plants is improved; the plant expression vector can be used for improving plant varieties.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the cysteine-rich protein gene of horse rind IlCDT1 and a plant expression vector and a construction method thereof. Background technique [0002] Heavy metal pollution refers to environmental pollution caused by heavy metals or their compounds. The area of ​​heavy metal pollution in my country's cultivated land accounts for about 1 / 6 of the total cultivated land, and the probability of cadmium (Cd) pollution is 25.20%, far exceeding other heavy metal elements in soil [1] . Cadmium is one of the most toxic heavy metal elements and has a strong ability to migrate in the water-soil-plant system, seriously affecting agricultural production, agricultural product safety and human health [2] . Soil cadmium pollution remediation technology specifically includes two categories, namely physical and chemical remediation and biological remediation. Phytoremediation refers to the use of p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00C07K14/415
Inventor 顾春笋刘凉琴王芝权张永侠黄苏珍
Owner INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com