Iris ensata thumb cysteine-rich protein gene IlCDT1 as well as plant expression vector and construction method thereof
A technology for plant expression vectors and protein enrichment, which is applied in the field of IlCDT1, the cysteine-rich protein gene IlCDT1 of Sinus chinensis and its plant expression vector and construction, to achieve the effect of plant variety improvement and heavy metal resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 IlCDT1 clone
[0029] Choose Ma Lin ( Iris lactea var. chinensis ) as material, with 100 µM CdCl 2 Treat the Iris seedlings, take the roots 24 hours later, extract the total RNA from the roots according to the instructions of the Trizol RNA Extraction Kit (TaKaRa), and reverse transcribe 1 μg of the total RNA into cDNA.
[0030] Using the extracted leaf cDNA as a template, design primers IlCDT1-F and IlCDT1-R for PCR reaction:
[0031] Upstream primer IlCDT1-F: ATGTATCCACCACCATCAGCA (SEQ ID NO.4)
[0032] Downstream primer IlCDT1-R: GAGCAGATTTGAATGCCTAA (SEQ ID NO.5)
[0033] 50 μL reaction system: 10×RCR Buffer 5.0 μL, IlCDT1-F, IlCDT1-R primers 1.0 μL each (20 μmol L -1 ), dNTP mix 4.0 μL (2.5 mmol·L -1 ), Taq DNA Polymerase 0.2 μL, cDNA template 1 μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95 °C for 4 min, then melting at 94 °C for 30 sec, annealing at 55 °C for 30 sec, extension at 72 °C for 2 min, 32 cycles of reaction, and ext...
Embodiment 2
[0034]Example 2. Construction of plant expression vector pMDC43-IlCDT1
[0035] Design primers IlCDT1-ZF, IlCDT1-ZR for PCR reaction, in the target gene IlCDT1 Respectively introduce enzyme cutting sites upstream and downstream Bam HI and not I, the PCR product is connected to the pMD19-T Simple vector, transformed into TOP10 competent cells, and the positive plasmid is extracted, Bam HI and not I double digested IlCDT1 fragment with Bam HI and not I double-digested pENTRY1A ligated, transformed, extracted the positive plasmid pENTRY1A-IlCDT1, recombined into the expression vector pMDC43 after pENTRY1A-IlCDT1 linearization, extracted the positive plasmid, detected by electrophoresis and sequenced to verify that it was SEQ ID NO.1, specifically Proceed as follows:
[0036] Upstream primer IlCDT1-ZF: CGCGGATCCGGATGTATCCACCACCATCA (SEQ ID NO.2)
[0037] Downstream primer IlCDT1-ZR: TTGCGGCCGCGATACAGCAGCAGCATAG (SEQ ID NO.3)
[0038] (1) Using the root cDNA as a tem...
Embodiment 3
[0041] Example 3 Plant expression vector pMDC43- IlCDT1 Genetic transformation of Arabidopsis thaliana and identification of its resistance to heavy metals
[0042] (1) Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105
[0043] Pick a single colony of EHA105 from the YEB (50 ug / mL rifampicin) plate, inoculate it in 50 mL YEB liquid medium containing 50 ug / mL rifampicin, cultivate at 200 rpm at 28°C until the OD value is 0.5, and then Ice-bath the bacterial solution for 30 min, collect the bacterial cells by centrifugation, and suspend in 2 mL of pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200 uL / tube aliquoted for use. Take 10 uLpMDC43- IlCDT1 Carrier plasmid, add 200 uL EHA105 competent cells, ice bath for 30 min, freeze in liquid nitrogen for 5 min, 37°C for 5 min, add 800 uL YEB liquid medium, pre-cultivate at 28°C 200 rpm for 4 h, spread the bacterial solution on YEB (50 ug / mL rifampicin + 50 ug / mL kanamycin) on solid medium, cul...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap