Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice M12 line
A specific, M12 technology, applied in the field of biotechnology, can solve the problems of large quantity and increased detection difficulty, and achieve the effect of accurate quantitative results, accurate and sensitive results, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The inventors of the present invention for the first time amplified transgenic rice M12 line-specific genes by real-time fluorescent PCR (probe method). The probe sequence of the transgenic rice M12 strain-specific gene primer used was upstream primer RB-F2 CTAGAGGATCCCGGACGAGTG (SEQ ID No.1), downstream primer RB-R2ATGAGTGGTAGCGTCCAGAAGGAAA (SEQ ID No.2); the probe was RB-P2CTGGGGCAGATAAGCAGTAGTGGTGGG (SEQ ID No. ID No.3).
[0026] 1. Main testing instruments used:
[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.
[0028] 2. Main reagents for detection:
[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.
[0030] 3. Main steps of detection:
[0031] Real-time fluorescent PCR reaction system:
[0032] 2×Mastermix 12.5μL
[0033] Upstream primer (10mM) 1.0μL
[0034] Downstream primer (10mM) 1.0μL
[0035...
Embodiment 2
[0046] In this example, the gene copy number of transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice M12 strain. The probe sequence of the transgenic rice M12 strain-specific primer used is the upstream primer M12-F1 GAGAACAAGAAGCCCCTTCTGTCTCG (SEQ ID No.1), and the downstream primer is M12-R1AAGGTACTAAAGCTTGAAAATCCTAAGGC (SEQ ID No.2); the probe is M12 - P1CACATTCGGCAGTGAAACTCTTGAGCGCC (SEQ ID No. 3).
[0047] 1. Main testing instruments used:
[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.
[0049] 2. Main reagents for detection:
[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.
[0051] 3. Main steps of detection:
[0052] Digital PCR reaction system:
[0053] 2×Mastermix 10 μL
[0054] Upstream primer (10mM) 1.0μL
[0055] Downstream primer (10mM) 1.0μL
[0056] Probe (10mM) 0.5μL
[...
Embodiment 3
[0065] The method is the same as that described in Example 2, except that the genomic DNA of the transgenic rice sample is first diluted 5 times and then diluted 10 times in 3 gradients as a template, and each dilution gradient is repeated 3 times, using transgenic rice M12 amplification primers The probe sequence was the same as that in Example 2, and quantitative detection by digital PCR was carried out to determine the sensitivity of the method.
[0066] Such as Figure 4 As shown, when the blank control (sterile double distilled water) has no amplification signal, the contents of the stock solution and its diluted 2.5 times, 5 times, and 10 times are 636 copies / μL, 211.33 copies / μL, 135.67 copies / μL, 74.47copies / μL, the deviation is between -6.20%-14.48%, which is basically in line with its theoretical copy number, and the RSD value of the three repetitions of each dilution gradient is between 0.49%-3.02% ( Figure 4 ), indicating that the precise quantitative detection m...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com