Application of T3 DNA ligase and T4 RNA ligase 2 in detection of N6 methyladenine
A technology of methyladenine and ligase, which is applied in the field of biological analysis, can solve the problem of low sensitivity and achieve the effect of high sensitivity, good specificity and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] T3 DNA ligase in the detection of long non-coding RNA (lncRNA, MALAT1) 2577 m in HeLa cells 6 The application of A content, the detection principle is as follows: figure 1 As shown, the specific detection method is as follows:
[0038] 1. According to the RNA sequence containing the 2577 position of MALAT1 (RNA2577-A) 5'-CUUAAUGUUUUUUGCAUUGG A CUUUGAGUUAAGAUUAUUUUUUAAAUCCUGAGGACUAGCAUUAAUUGAC-3' (the underlined base is the 2577 position, and the 2577 position of MALAT1 in HeLa cells is partly A and partly m 6 A) Design and synthesize the left probe (LigaseL2) and the right probe (Ligase R2), wherein the base sequence of Ligase L2 is 5'-po 4 CCAATGCAAAAA -3' (the underlined part is the detection recognition region, and the italic part is the PCR primer region, provided by Treasure Bioengineering (Dalian) Co., Ltd.), the base sequence of Ligase R2 is 5'- CTTAACTCAAArGrU -3' (The underlined part is the detection recognition region, and the italicized part is the ...
Embodiment 2
[0048]T3 DNA ligase in the detection of long non-coding RNA (lncRNA, MALAT1) 2577 m in HCT116 cells 6 The application of A content, the specific detection method is as follows:
[0049] The probes Ligase L2 and Ligase R2 designed for RNA2577-A in Example 1 were used to detect the content of long non-coding RNA (lncRNA, MALAT1) 2577 site A in HCT116 cells, and the detection method was to use 106ng / μL polyA of HCT116 + RNA replaces poly A of HeLa + RNA, other experimental steps are identical with embodiment 1, and measure its real-time fluorescence curve respectively, and detection result is as follows Image 6 shown. According to the real-time fluorescence curve of RNA2577-A, draw the C for detecting RNA2577-A T Value (the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold value) and the linear relationship curve of the logarithmic value of the RNA2577-A concentration, the results are as follows Figure 7 shown, and the ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com