Primer and method for rapidly distinguishing larimichthys polyactis and larimichthys crocea and determining hybrid variety of larimichthys polyactis and larimichthys crocea
A technology of large yellow croaker and small yellow croaker, applied in biochemical equipment and methods, microbiological measurement/inspection, DNA/RNA fragments, etc., can solve the problems of inability to identify hybrids and small yellow croakers, morphological identification is not necessarily accurate, easy to be confused, etc. problem, to achieve the effect of quick identification method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0016] (1) Select small yellow croaker, large yellow croaker and hybrid fish [small yellow croaker (♀) and large yellow croaker (♂)] for professional morphological identification;
[0017] (2) Extract the DNA of small yellow croaker, large yellow croaker and hybrid fish samples by phenol-chloroform extraction method;
[0018] (3) The PCR amplification reaction system is: 10×Buffer 2.5 μl, dNTP 2.0 μl, Taq enzyme 0.2 μl, upstream primer and downstream primer 1 μl, DNA template 1 μl, ddH2O 18.3 μl; PCR amplification reaction conditions are: 94°C After pre-denaturation for 5 minutes, enter 35 cycles: 94°C for 35sec, 59°C for 35sec, 72°C for 1.0min; finally, extend at 72°C for 10min;
[0019] Upstream primer: 5'- GGTGGTGGCAAAATTTGATT -3' (as shown in SEQ ID No.1);
[0020] Downstream primer: 5'-CCACACACCTAATGCCTCCT-3' (as shown in SEQ ID No.2);
[0021] (3) Electrophoresis staining comparison pattern: After the PCR reaction, 8 μL of the product was detected by agarose gel electr...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com