Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene detection or gene typing composition and method thereof

A technology of genotyping and gene detection, applied in biochemical equipment and methods, recombinant DNA technology, measurement/testing of microorganisms, etc., can solve the problems of gene detection and genotyping without DNA silencing phenomenon, and achieve simple gene detection or genotyping effects

Pending Publication Date: 2017-04-05
德诺杰亿(北京)生物科技有限公司
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] To date, there have been no reports of the use of DNA-mediated DNA silencing for genetic testing and / or genotyping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection or gene typing composition and method thereof
  • Gene detection or gene typing composition and method thereof
  • Gene detection or gene typing composition and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1 PCR process

[0044] The 5'UTR of HCV 1a genotype was selected as the target, and its sequence is as follows:

[0045] GCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCG GGAGAGCCATAGTGGTCTG CGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCC CCGGGAGGTCTCGTAG ACCGTGCACC (SEQ ID NO: 1).

[0046] Design the target enrichment primers as follows (underlined) according to the routine requirements in this field:

[0047] F: GGAGAGCCATAGTGGTCTG (SEQ ID NO: 2),

[0048] R: CTACGAGACCTCCCGG (SEQ ID NO: 3).

[0049] The size of the target sequence amplified by the two primers is 200bp.

[0050] Prepare PCR reaction solution: 20mM Tris / HCl, pH 8, 250mM KCl, 300μM Mg 2+ , 250μM upstream and downstream primers, 5U Taq enzyme, template amount 10ng. PCR reaction conditions...

Embodiment 2

[0051] Embodiment 2 positioning cutting process and electrophoresis process

[0052] 2.1 Length of positioning primer

[0053] In various genetic tests, one or more gene variations may occur, and these genes may be the human body's own genes or pathogen genes. Targeting primers with different bases and different lengths need to be designed for different target gene targets. The present invention can use more than 12bp positioning primers. In 20mM Tris / HCl, pH 8, 300μM Mg 2+, 75°C for 1 hour, the following positioning primers (double strands) with a length of 5 to 80 bp were respectively mixed with 5 μg of cutting enzyme (Argonaute enzyme, derived from Thermus thermophiles, see http: / / www.ncbi. nlm.nih.gov / gene / ?term=TTHB068) and 500ng target gene (PCR product in Example 1) react together, the results are shown in figure 2 . Depend on figure 2 It can be seen that the positioning primers of 12, 20, 40, and 80 bp can all achieve cleavage. Longer positioning primers highe...

Embodiment 3

[0077] Embodiment 3 The example of positioning cutting reaction process

[0078] The target gene used in the above examples is the 5'UTR of HCV 1a genotype, and for a 5'UTR of HCV 3a genotype, the CTG position of the target target corresponds to TCA. Therefore, when using the positioning primers of the above-mentioned embodiments, it is impossible to perform cleavage to form fragments of corresponding sizes. This example again verified the efficacy of the system of the present invention for the 5'UTR of HCV 3a genotype. Specifically, the target enrichment primer and its implementation in this example are the same as in Example 1, and the positioning double-stranded primer is designed at the same time: P-AAGATCACTAGC (SEQ ID NO: 15), and the positioning primer is HCV 3a genotype-specific . Other reaction conditions are with embodiment 2. The results showed that when using the positioning primer and Agonaute enzyme, the fragment of the amplified HCV 3a genotype 5'UTR could be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene detection and / or gene typing composition and a method thereof. Concretely speaking, the invention relates to the gene detection and / or gene typing composition, and the method for detecting and / or typing gene by using the composition, and more specifically relates to the composition by using Argonaute enzyme and a positioning primer for gene detection or gene typing and the method for gene detection or gene typing by using the composition. The composition and the method overcome the technical defect of the current technologies of multiple PCR and restriction map, and can rapidly and easily perform gene detection or gene typing.

Description

technical field [0001] The present invention relates to a composition for genetic detection or genotyping and a method for genetic detection or genotyping using the composition, in particular to a composition for genetic detection or genotyping by using Argonaute enzyme and positioning primers and A method for genetic detection or genotyping using the composition. Background technique [0002] Multiplex PCR (multiplex PCR), also known as multiple primer PCR or composite PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. Its reaction principle, reaction reagents and The operation process is the same as that of general PCR. At present, this technology has been widely used in biotechnology, quarantine and medical testing and other fields. However, since the working principle of multiplex PCR is to add multiple pairs of primers to the same PCR reaction system to simul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q1/707C12Q2600/156C12Q2521/327C12Q2531/113C12Q2565/125
Inventor 林小靖
Owner 德诺杰亿(北京)生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com