Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

5'-UTR element and application thereof in production

A component and purpose technology, applied in the application field of L-alanine fermentation production, can solve problems such as poor stability and heavy metabolic burden

Active Publication Date: 2017-03-08
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, increasing the expression of alanine dehydrogenase only through the copy number of the plasmid has the disadvantages of poor stability and heavy metabolic burden. Expression level, improve the performance of engineering bacteria fermentation to produce L-alanine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 5'-UTR element and application thereof in production
  • 5'-UTR element and application thereof in production
  • 5'-UTR element and application thereof in production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0170] Example 1. Construction of E.coli K-12 W3110△metA△ilvA△lysA△tdh△tdcC△sstT

[0171] Using Escherichia coli K12 W3110 as the starting strain, the metA gene (the gene encoding homoserine succinyltransferase), the ilvA gene (the gene encoding threonine deaminase), and the lysA gene (the gene encoding the decarboxylation of diaminopimelic acid) were sequentially deleted. enzyme gene), tdh gene (the gene encoding threonine dehydratase), tdcC gene (the gene encoding the threonine uptake transporter) and sstT gene (the gene encoding the threonine uptake transporter), to obtain the chassis engineering bacteria , named it E.coli K-12W3110△metA△ilvA△lysA△tdh△tdcC△sstT.

[0172] 1. Knock out the metA gene

[0173] (1) The genomic DNA of Escherichia coli K12 W3110 was used as a template, and the primer pair composed of WY569 and WY570 was used for PCR amplification to obtain DNA fragment I-A (upstream region of the metA gene).

[0174] (2) Using the genomic DNA of Escherichia coli...

Embodiment 2

[0226] Example 2. Attenuator mutants regulate the expression of the lacZ gene

[0227] 1. Construction of recombinant plasmid pACYC184-P PL

[0228] 1. Synthesize the double-stranded DNA molecule shown in sequence 13 of the sequence listing (promoter P PL ).

[0229] 2. Using the double-stranded DNA molecule prepared in step 1 as a template, the primer pair composed of WY843 and WY842 is used for PCR amplification to obtain a PCR amplification product.

[0230] WY843: TGC TCTAGA CAATTCCGACGTCTAAGAAA;

[0231] WY842: CCC AAGCTT GGTCAGTGCGTCCTGCTGAT.

[0232] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.

[0233] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).

[0234] 5. Ligate the digested product of step 3 with the vector backbone of step 4 t...

Embodiment 3

[0290] Embodiment 3, attenuator mutant regulates the expression of gfp gene

[0291] 1. Construction of recombinant plasmids

[0292] Construct the following six recombinant plasmids: pACYC184-P PL -thrLA-gfp914, pACYC184-P PL -thrLA-gfp1630, pACYC184-P PL -thrLA-gfp1629, pACYC184-P PL -thrLA-gfp1628, pACYC184-P PL -thrLA-gfp1627 and pACYC184-P PL -thrLA-gfp913.

[0293] pACYC184-P PL -thrLA-gfp914 with pACYC184-P PL -thrLA-lacZ914 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by specific DNA molecule X.

[0294] pACYC184-P PL -thrLA-gfp1630 with pACYC184-P PL -thrLA-lacZ1630 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by a specific DNA molecule X.

[0295] pACYC184-P PL -thrLA-gfp1629 with pACYC184-P PL -thrLA-lacZ1629 differs only in that: the lacZ gene shown in sequence 15 of the sequence listing is replaced by a specific DNA molecule X.

[0296] pACYC184-P PL -thr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 5'-UTR element and an application thereof in production, in particular an application in L-alanine fermentation production. Firstly, the invention provides a DNA molecule A, which is shown as the 294th-n1st nucleotide of a sequence 14 in a sequence list, wherein n1 is a natural number which is greater than 310 and less than 606. The invention also discloses an application of the DNA molecule A, as a regulatory element, in promoting the expression of a target gene. The invention also discloses a DNA molecule C, wherein the DNA molecule C, from upstream to downstream, sequentially consists of the following elements: the DNA molecule A and a gene for encoding alanine dehydrogenase. The invention also discloses a recombinant bacterium C containing the DNA molecule C. The invention also discloses an application of the recombinant bacterium C in producing L-alanine. According to the invention, a nucleotide sequence, which can effectively enhance gene expression, is obtained, a strain for producing the alanine is constructed and a novel method for the improved alanine fermentation production is provided.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a 5'-UTR element and its application in production, especially the application in L-alanine fermentation production. Background technique [0002] To express a target protein in a bioreactor, usually a DNA molecule having a promoter and a gene encoding the target protein is introduced into the bioreactor, and the promoter promotes the expression of the coding gene to obtain the target protein. Therefore, increasing the expression ability of the target protein has great application prospects. [0003] L-alanine is a non-essential amino acid for the human body. It has a sweet taste, is easily soluble in water, and has a wide range of applications. In the food industry, L-alanine can improve the taste and protein utilization of food. In the field of medicine, L-alanine is often used as amino acid nutritional medicine, and at the same time, L-alanine is also an important raw material for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N1/21C12P13/06C12R1/19
CPCC12N9/0016C12P13/06C12Y104/01001
Inventor 刘树文温廷益商秀玲张芸
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com