Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human-STAT6-targerted CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system and application thereof in treating allergic diseases

A targeted technology for allergic diseases, applied in the field of genetic engineering, can solve problems such as low efficiency of the method, and achieve the effects of improving efficiency, saving costs, and high efficiency

Active Publication Date: 2016-12-14
GEMPHARMATECH CO LTD
View PDF2 Cites 34 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The problem of low efficiency of homologous recombination method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human-STAT6-targerted CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system and application thereof in treating allergic diseases
  • Human-STAT6-targerted CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system and application thereof in treating allergic diseases
  • Human-STAT6-targerted CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system and application thereof in treating allergic diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The design of embodiment 1sgRNA

[0051] First, select the 5'-GGN(19)GG sequence based on the STAT6 gene shown in SEQ ID NO: 1. If there is no 5'-GGN(19)GG sequence, 5'-GN(20)GG or 5'- N(21)GG also works. The targeting site of the sgRNA on the STAT6 gene is located in the exon of the gene. Use BLAT in the UCSC database or BLAST in the NCBI database to determine whether the target sequence of the sgRNA is unique. At the same time, according to the design rules of other sgRNAs, a total of 97 sgRNAs were designed. However, the final experiment confirmed that only 15 of them had the function of targeted modification. Here, the sequences without functions are not listed one by one, only given 3 counter-examples, which also fully demonstrate that in the prior art, the design of sgRNA cannot obtain functional sgRNA only according to the design rules without experiments. The sgRNA sequence involved in the present invention is as follows:

[0052] STAT6-sg1: ggaagtgcccgctgaga...

Embodiment 2

[0070] Embodiment 2, construct the oligonucleotide duplex of sgRNA

[0071] According to the selected sgRNA: STAT6-sg1, add CCGG to its 5' to get a forward oligonucleotide (Forwardoligo) (if the sequence itself already has 1 or 2 Gs at the 5' end, then omit 1 or 2 accordingly G): According to the selected sgRNA, obtain the complementary strand of its corresponding DNA, and add AAAC to its 5' to obtain a reverse oligonucleotide (Reverseoligo). The above-mentioned forward oligonucleotide and reverse oligonucleotide were synthesized respectively. For STAT6-sg1: ggaagtgcccgctgagaaagg, the forward oligonucleotide (Forward oligo) designed was: CCggaagtgcccgctgagaaagg (SEQ ID NO: 20); reverse oligonucleotide The nucleotide (Reverse oligo) is aaaccctttctcagcgggcac (SEQ ID NO: 21).

[0072] The forward oligo and reverse oligo of the synthesized sgRNA oligonucleotide are denatured and annealed in pairs, and after annealing, a double strand that can be connected to the U6 eukaryotic exp...

Embodiment 3

[0075] Embodiment 3, the construction of sgRNA oligonucleotide plasmid

[0076] 1. Linearize the pGL3-U6-sgRNA plasmid. Enzyme digestion system and conditions are as follows: 2 μg pGL3-U6-sgRNA (400ng / μl); 1 μl CutSmart Buffer; 1 μl BsaI (NEB, R0535L); replenish water to 50 μl, incubate at 37 degrees for 3-4 hours, shake and centrifuge at intervals To prevent droplets from evaporating onto the tube cap.

[0077] 2. Ligate the annealed sgRNA oligonucleotide duplex to the linearized pGL3-U6-sgRNA plasmid to obtain the pGL3-U6-stat6-sg1 plasmid.

[0078] 3. Transform and coat Amp+ plates (50 micrograms / ml).

[0079] 4. Identify positive clones by sequencing with the universal primer U6, said primer being atggactatcatatgcttaccgta.

[0080] 5. Shake the bacteria overnight on a 37-degree shaker and extract the pGL3-U6-stat6-sg1 plasmid with a plasmid extraction kit.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats) knock-out system for carrying out gene knock-out on STAT6. According to the system, a plurality of sgRNAs (small guide ribonucleic acids) can be utilized to implement high-efficiency knock-out on the STAT6 gene. The sgRNAs capable of specific STAT6-gene-targeted knock-out in the CRISPR-Cas9 are designed and synthesized; and the sgRNA oligonucleotide vector and the enzyme digestion plasmid are utilized to respectively and successfully transfect cells, thereby implementing STAT6 gene knock-out. The invention provides a scheme for quickly, simply, efficiently and specifically knocking out STAT6 by using Cas9 / sgRNA. The efficiency is high, and the STAT6 knock-out efficiency reaches 80% or above. The system can be used for knocking out the single coded sequence or segment of STAT6. The sgRNAs can be massively produced only by synthesizing a small amount of polynucleotide segments, thereby saving the cost and enhancing the efficiency.

Description

technical field [0001] The present invention relates to the field of genetic engineering, and more specifically relates to a CRISPR-Cas9 method for specifically knocking out the human STAT6 gene and an sgRNA for specifically targeting the STAT6 gene. Background technique [0002] Bronchial asthma (referred to as asthma) is a chronic airway inflammation involving eosinophils, mast cells, T cells, and white blood cells and other cells and cell components, accompanied by airway hyperresponsiveness on the basis of chronic inflammation And airway remodeling (airway remodelling), the essence of which is chronic inflammation of the airway. Asthma is a world-recognized medical problem, listed by the World Health Organization as one of the four major chronic diseases. Over the past ten years, the morbidity and mortality of asthma in many countries and regions in the world have been on the rise, and this phenomenon has attracted the attention of the World Health Organization (WHO) an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/85A61K48/00A61K31/7105A61P37/08
CPCA61K31/7105C07K14/47C12N15/113C12N15/85C12N2310/10
Inventor 李蒙
Owner GEMPHARMATECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com