Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene detection kit for myopia risk assessment and detection method thereof

A risk assessment and genetic detection technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve problems such as blurred vision and excessive growth of the eyeball, so as to reduce the risk of myopia, prevent or reduce the risk of myopia Effect

Active Publication Date: 2016-08-17
SHENZHEN INST OF ZHONGMEI GENOMICS CO LTD
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Once this type of gene is defective, the eyeball may grow excessively, resulting in blurred vision when viewing distant objects, and the formation of myopia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection kit for myopia risk assessment and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036] (1) PCR reaction primer set for the SNP polymorphic sites of the two genes (the following primer sequence directions are all from 5' end to 3' end):

[0037]Primer set for SNP rs189798:

[0038] 1 GTAGTGCTGGTGG

[0039] 2 CAGAGAGAGCACTTCAG

[0040] 3 GACAGA GACATTGAGGC

[0041] 4 GGAATACTGCAAGATCCGT

[0042] Primer set for SNP rs10034228:

[0043] 1 GGTGCTCTCT CAAGCCTTTG

[0044] 2 CTTTTGTGCCTCCACTATTC

[0045] 3 GAAGAAGTCA GAGATGTGTAT

[0046] 4 GACTGCCACACTAACAAAT

[0047] (2) PCR amplification reagent: 10×PCR buffer, the PCR buffer is 100mM Tris-HCl pH8.3, 500mM KCl, 15mM MgCl2; dNTPs mixture, the dNTPs mixture is guanine deoxynucleotide triphosphate dGTP, Adenine deoxynucleotide triphosphate dATP, thymidine triphosphate dTTP, cytosine deoxynucleotide triphosphate dCTP four nucleotides, the concentration of each component is 2.5mM; 5U / μl hot start Taq enzyme ;

[0048] (3) Reagents for agarose gel electrophoresis analysis: agarose, TAE buffer, DNA molecular...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene detection kit for myopia risk assessment and a detection method thereof. The gene detection kit comprises a kit body and a reagent individually stored in the kit body, wherein the individually stored reagent contains 1 a PCR reaction primer group targeted to SNP polymorphic sites of two genes, 2 a PCR amplification reagents and 3 an agarose gel electrophoresis analysis reagent. The gene detection kit makes multiple PCR amplification reactions simultaneously performed on the same PCR instrument by adopting the design of PCR primers, detects related genes of subjects, achieves high efficiency and specificity of detection, analyzes the risks of tending to high myopia of the subjects through, finds myopic heredities and genetic intrinsic factors of the subjects, can well provide scientific references for the subjects, helps the subjects to improve and change living and working habits so as to prevent or reduce the myopia risk of, and meanwhile adopts corresponding strategies in daily life to avoid invalid or even harmful methods.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a gene detection kit for myopia risk assessment and a detection method thereof. Background technique [0002] Myopia refers to the refraction of parallel light rays by the refractive system of the eye when the eye is in a relaxed state, and the light is focused in front of the retina instead of on the retina. This is usually caused by the thickening and aging of the lens. Myopia is affected The joint influence of innate genetic factors and acquired environmental factors. Surveys have shown that the occurrence of myopia is largely influenced by heredity. If both parents are myopic, the chance of children being myopic is as high as 33-60%; if one parent is myopic, the chance of children being myopic is reduced to 23-40%; 6-15%. The gene linked to nearsightedness plays a key role in eye development and the transmission of visual signals to the brain. Once this type of gene is defec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 李则轩
Owner SHENZHEN INST OF ZHONGMEI GENOMICS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com