Mimic electrochemical immunosensor for detecting beta-amyloid protein oligomers and preparation method thereof
An amyloid protein and oligomer technology, applied in the field of biosensing and electroanalytical chemical detection, to achieve high selectivity, early diagnosis and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Preparation method of an immune-like biosensor for detecting Aβ oligomers
[0030] (1) Conjugation of aptamer and thionine on AuNPs
[0031] A nucleic acid aptamer with a strong binding ability to the Aβ oligomer was selected, its sequence is: GCCTGTGTTGGGGCGGGTGCG, and the 5'SHC6 was modified.
[0032] Preparation of AuNPs solution with a diameter of 20 nm: Add 3.75 mL of 1% (mass percentage) sodium citrate solution to boiling 250 mL of 0.01% (mass percentage) HAuCl under rapid stirring 4 4H 2 O solution, it was observed that the color of the solution would change from light yellow to deep purple within 2 minutes. Keep the mixed solution continuously boiling and stirring for 15 min, and cool to room temperature to obtain the AuNPs solution, which is stored in a refrigerator at 4°C for later use. Then, mix the prepared 7mL AuNPs and 2mL 1mM thionine solution, stir at room temperature for 24h, centrifuge (8000r / min, 15min), remove the lower layer, and then d...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com