Supercharge Your Innovation With Domain-Expert AI Agents!

Mimic electrochemical immunosensor for detecting beta-amyloid protein oligomers and preparation method thereof

An amyloid protein and oligomer technology, applied in the field of biosensing and electroanalytical chemical detection, to achieve high selectivity, early diagnosis and good specificity

Active Publication Date: 2016-06-08
SHANGQIU NORMAL UNIVERSITY
View PDF6 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no related report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mimic electrochemical immunosensor for detecting beta-amyloid protein oligomers and preparation method thereof
  • Mimic electrochemical immunosensor for detecting beta-amyloid protein oligomers and preparation method thereof
  • Mimic electrochemical immunosensor for detecting beta-amyloid protein oligomers and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation method of an immune-like biosensor for detecting Aβ oligomers

[0030] (1) Conjugation of aptamer and thionine on AuNPs

[0031] A nucleic acid aptamer with a strong binding ability to the Aβ oligomer was selected, its sequence is: GCCTGTGTTGGGGCGGGTGCG, and the 5'SHC6 was modified.

[0032] Preparation of AuNPs solution with a diameter of 20 nm: Add 3.75 mL of 1% (mass percentage) sodium citrate solution to boiling 250 mL of 0.01% (mass percentage) HAuCl under rapid stirring 4 4H 2 O solution, it was observed that the color of the solution would change from light yellow to deep purple within 2 minutes. Keep the mixed solution continuously boiling and stirring for 15 min, and cool to room temperature to obtain the AuNPs solution, which is stored in a refrigerator at 4°C for later use. Then, mix the prepared 7mL AuNPs and 2mL 1mM thionine solution, stir at room temperature for 24h, centrifuge (8000r / min, 15min), remove the lower layer, and then d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mimic electrochemical immunosensor for detecting beta-amyloid protein (ABeta) oligomers and preparation method thereof and belongs to the technical field of biosensing and electroanalytical chemistry. gold nanoparticles jointly act with sulfhydryl-modified aptamer and thionine to form a stable nano conjugate; an antibody is fixed to the surface of a carboxylic graphene oxide modified electrode; after an ABeta oligomer is recognized, the oligomer is further connected with the aptamer modified gold nanoparticle conjugate, thus forming a sandwich mimic immunosensor; the ABeta oligomer is measured through thionine electrochemical signals. The immunosensor has high sensitivity, good specificity and high stability; compared with traditional immunosensors, the immunosensor features preparation simplicity and avoidance of the use of enzyme-labeled antibody reagents, is useful in the detection of ABeta oligomers in cerebrospinal fluid to promote early diagnosis of Alzheimer's disease and has clinical applicable value.

Description

technical field [0001] The invention relates to an immunoelectrochemical sensor for detecting β-amyloid oligomers and a preparation method thereof, in particular to a method for recognizing β-amyloid oligomers by forming a sandwich structure with antibodies and nucleic acid aptamers The invention discloses a body-like immunoelectrochemical sensor and a preparation method thereof, which belong to the technical field of biosensing and electroanalytical chemical detection. Background technique [0002] As our country enters an aging society, the incidence of Alzheimer's disease (AD) is gradually increasing, seriously endangering the physical and mental health of the elderly and affecting the quality of life. The detection of AD markers is an important way to achieve early diagnosis and understand the development of the disease. Studies have shown that the occurrence of AD is closely related to the formation of amyloid plaques in the brain. Plaque formation is caused by excess...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N27/327G01N33/68
CPCG01N27/3278G01N33/6896
Inventor 周艳丽刘澜涛常竹张欢庆徐茂田
Owner SHANGQIU NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More