Bovine, goat, porcine and canine brucella typing fluorescent PCR (polymerase chain reaction) detection reagent kit and preparation and application thereof
A detection kit, the technology of Brucella bovis, applied in the field of biotechnology detection, can solve the problems of affecting the epidemiological investigation and disease prevention of brucellosis, cumbersome experimental process, inability to type, etc., so as to reduce cross-contamination and environmental problems. Risk of contamination, improved detection efficiency, and the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The preparation and use method of embodiment 1 kit
[0048] Design and synthesize primers and probes for Brucella bovis, primers and probes for Brucella ovis, primers and probes for Brucella suis, primers and probes for Brucella canis, respectively. The nucleotide sequence is shown in Table 1 below:
[0049] Table 1
[0050]
[0051] The above-mentioned sets of primer pairs and probes can be packaged individually, or can be combined to make a multiple fluorescent PCR detection mixture. The amount of each of the above-mentioned primers and probes contained in the multiplex fluorescent PCR detection mixture can be the conventional amount known to those skilled in the art.
[0052] That is to say, the kit of the present invention may contain the aforementioned independently packaged sets of primer pairs and probes, or may contain a configured multiplex fluorescent PCR detection mixture containing each set of primer pairs and probes.
[0053] Further, the kit can also...
Embodiment 2
[0057] The sensitivity analysis of embodiment 2 kit
[0058] 1. Experimental method
[0059] 1.1 Preparation of multiple fluorescent PCR detection mixture:
[0060] According to the conventional dosage in this field, configuration contains four sets of primer pairs and probe, dNTP, ddH in Example 1 2 O, Mg 2 +, 2xPCR buffer multiplex fluorescent PCR detection mixture, a total of 36 μl.
[0061] 1.2 Preparation of the positive control substance for Brucella typing:
[0062] The method for constructing the positive control plasmid of Brucella bovis: the amplicon sequence of Brucella bovis was chemically synthesized and constructed on the vector pGH. The cloning site is SmaI. The amplicon sequence length of the inserted Brucella bovis is 171bp, and the nucleotide sequence is as shown in SEQ ID NO.13, specifically:
[0063] GCAACAATTCACGTCATGATGGCCAATACGGCGATTTCAGCGATGATCGTGATGTCGCTGATGGCGGCGTAAGCACCGGCAAGATCGCCTACACCTTCACCGGCGGAAACGGCTTCTCGCTGTGATCGCTCTCGAACAGGGTGGCGAAGACGT...
Embodiment 3
[0086] Application of embodiment 3 kit
[0087] 1. Experimental method
[0088] 1.1 Experimental objects
[0089] Adopt the following samples of kit of the present invention to carry out fluorescence detection: 2 examples of Brucella bovis whole blood leukocyte samples (numbering is SA-1, SA-2), 1 example of human whole blood leukocyte samples (numbering is SA-3) and 1 case of milk (coded SA-4); 2 cases of whole blood leukocyte samples of Brucella sheep (coded SM-1, SM-2), 2 cases of human whole blood leukocyte samples (coded SM-3, SM- 4); 3 cases of Brucella suis whole blood leukocyte samples (numbered SS-1, SS-2, SS-3), 1 case of vaginal secretions (numbered SS-4); whole blood samples of Brucella canis 3 examples of white blood cell samples (numbered as SC-1, SC-2, SC-3), 1 example of vaginal secretions (numbered as SC-4), and a positive control (SA Yangshen is prepared in Example 2 with a concentration of 4x10^ 7 The brucella bovis positive control plasmid of copies / m, ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com